ID: 1050301276

View in Genome Browser
Species Human (GRCh38)
Location 9:4261256-4261278
Sequence AGAGCTGCTCACATTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050301276_1050301283 10 Left 1050301276 9:4261256-4261278 CCCAATTCAATGTGAGCAGCTCT 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1050301283 9:4261289-4261311 GATACATGAGAGTGAGACGTGGG No data
1050301276_1050301282 9 Left 1050301276 9:4261256-4261278 CCCAATTCAATGTGAGCAGCTCT 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1050301282 9:4261288-4261310 GGATACATGAGAGTGAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050301276 Original CRISPR AGAGCTGCTCACATTGAATT GGG (reversed) Intronic
901094569 1:6667874-6667896 AGAGCTGCAGCCATTGATTTTGG + Intronic
907096890 1:51790297-51790319 AGAGCTGCTCTGATTGAAATTGG + Intronic
909075376 1:71046416-71046438 AGGGCTGCTCACATTCTAGTCGG - Intronic
911730221 1:101284670-101284692 AGGACTGGTCAGATTGAATTAGG - Intergenic
915384619 1:155478674-155478696 ACAGCTGCTCCCATAGGATTAGG - Exonic
921081499 1:211742261-211742283 AGACCTTCCCACATTGAATCTGG + Intergenic
921780789 1:219160881-219160903 AGAGCTGCTAATATTGCTTTAGG + Intergenic
1063290908 10:4746717-4746739 AGAGATGCTTACGTAGAATTTGG - Intergenic
1065453515 10:25882699-25882721 GGAGCTGCTGTCACTGAATTGGG + Intergenic
1065587275 10:27231690-27231712 AGAGCAGCTCTAATTTAATTTGG - Intronic
1066183062 10:32981891-32981913 AGTGCTGCTCACAGTGAACTTGG - Intronic
1066641590 10:37559561-37559583 AACACTGCTCAGATTGAATTAGG + Intergenic
1067205447 10:44208377-44208399 AGGGCTGAGCACATAGAATTTGG - Intergenic
1069144013 10:64866030-64866052 AAAGGTCCACACATTGAATTGGG + Intergenic
1069921530 10:71818605-71818627 TGAGCTACTCACATTGCACTGGG + Exonic
1071265148 10:83958136-83958158 AGAGCTGGGCACATGGAAATGGG - Intergenic
1072370474 10:94761623-94761645 AGAGCTGATCTCAGAGAATTTGG - Intronic
1073176420 10:101560149-101560171 GGAGCTGCTCACATTCACTCAGG + Intergenic
1079284821 11:19119005-19119027 ATTACTGCTCTCATTGAATTTGG + Intronic
1080159064 11:29149814-29149836 AGAGCTGTTGACTTTTAATTTGG + Intergenic
1087704219 11:101470733-101470755 TCAGTTGCTCACATAGAATTTGG - Intronic
1088977827 11:114831520-114831542 AGAGCTGCTCTCATTGAAGCTGG + Intergenic
1090906216 11:131076750-131076772 TGAGCTGCTCACCTTGAAGGTGG - Intergenic
1091212269 11:133872222-133872244 AGAGCTCCTGCCACTGAATTGGG + Intergenic
1093255080 12:16856897-16856919 AGAGCAGCTTACAGAGAATTTGG + Intergenic
1094712239 12:32976336-32976358 ATAGCTGCTCACATACAGTTTGG - Intergenic
1095177287 12:39107669-39107691 AGAACTGTTCACATGTAATTAGG + Intergenic
1096261920 12:50098307-50098329 AGTGCTGCCCACACTGATTTTGG - Intronic
1097450168 12:59728356-59728378 AGAGCTGCTCACAGCCAATAGGG - Intronic
1099821343 12:87715010-87715032 AGACCTGCTCATCATGAATTTGG - Intergenic
1103689220 12:122757246-122757268 AGAGCAGCTCAAATTCATTTAGG + Intronic
1106259626 13:28054591-28054613 TTTGCTGCTCATATTGAATTGGG - Intronic
1108422798 13:50267719-50267741 AGGGCTGCTAACAGTAAATTGGG - Intronic
1109713495 13:66189204-66189226 AGGGAAGCTCACATTGACTTGGG + Intergenic
1111128560 13:83944127-83944149 AGAGCTGCTGCCATAGAACTGGG - Intergenic
1111859096 13:93678911-93678933 AGAGATGCTCATACTGAAATTGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117326439 14:54673230-54673252 TGTGCTGCTCCCATTGAAATTGG - Intronic
1122390846 14:101382212-101382234 AGAGCTCATCAGATTGTATTTGG - Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1125553960 15:40569201-40569223 TGAGCTGCTCGAATTAAATTAGG - Intergenic
1125573078 15:40735879-40735901 AGAGCTGATAACATCAAATTTGG + Exonic
1130406817 15:83609974-83609996 TGAGCTGCTCACTTTGAAGCTGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133431383 16:5740023-5740045 AGAACTGCTCTCTTTGAAATTGG + Intergenic
1133843294 16:9429738-9429760 AGAGGTGCTGACAATGGATTTGG + Intergenic
1134597805 16:15509887-15509909 AGATGAGCTCACATTGGATTAGG + Intronic
1134643607 16:15849056-15849078 AGAGCTGCTCTCAATGTTTTTGG + Intronic
1135061629 16:19275919-19275941 AGAGCTGCCCATCATGAATTAGG - Intergenic
1135155126 16:20046270-20046292 TGAGCTGCTCACTGTGAATCAGG + Intronic
1135498015 16:22969551-22969573 AGAGGTCATCACATTGAATAGGG - Intergenic
1140862335 16:79028921-79028943 ATAGCCGCTGACATTGAAGTTGG + Intronic
1141380035 16:83567970-83567992 AGTGCTGCCCACATTCACTTGGG + Intronic
1141824168 16:86467599-86467621 AGATCTGCTGACATGGAAGTGGG - Intergenic
1142516806 17:436816-436838 AGAGCTGCTCACACAGATGTTGG - Intergenic
1142613413 17:1121580-1121602 AGAGCTGCTCACAGTGGGATGGG + Intronic
1142613426 17:1121646-1121668 AGAGCTGCTCACAGTGGGATGGG + Intronic
1142613439 17:1121712-1121734 AGAGCTGCTCACAGTGGGATGGG + Intronic
1144146886 17:12407246-12407268 AGAGGAGCTCACTTTGAATTTGG - Intergenic
1146461984 17:33053502-33053524 AGGGATGCTTACATTGACTTGGG - Intronic
1153885517 18:9461169-9461191 TGCACTGCTCATATTGAATTAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155035709 18:22023192-22023214 AGAGCTGCTCAGATAGCTTTAGG - Intergenic
1155376649 18:25165476-25165498 AGAGCTGCTCACACTGTATGAGG - Intronic
1156554547 18:38052510-38052532 AGAGCTGAGCACATAGAAGTGGG - Intergenic
1157109781 18:44809777-44809799 AGAGCTTCTCATATATAATTTGG - Intronic
1159951381 18:74486718-74486740 AGAGCTTCTCACGGTGAACTGGG - Intergenic
1160209106 18:76861393-76861415 AGTCCTGCTCACATTCAGTTGGG + Intronic
1161386161 19:3994503-3994525 TGACCTGCTCACATTGAACAGGG + Intergenic
1163787171 19:19280805-19280827 AGAGCAGCTGACATTTAATTTGG + Intronic
929431580 2:41892186-41892208 AGAGCTGTCCAAATTGAAATTGG + Intergenic
931107894 2:59077418-59077440 AGAGCTGCACACATTTTCTTCGG - Intergenic
932101432 2:68903552-68903574 AGAGATATTGACATTGAATTTGG - Intergenic
933118714 2:78507488-78507510 AGAACTGCTCTGATTGAAGTTGG + Intergenic
934631212 2:95925135-95925157 AGAGTTCCCTACATTGAATTTGG - Intronic
934802833 2:97183849-97183871 AGAGTTCCCTACATTGAATTTGG + Intronic
934833503 2:97558592-97558614 AGACTTCCTCACATTGAAATTGG - Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939733209 2:145810770-145810792 AGAGGTGCCCACATTCCATTTGG - Intergenic
940431599 2:153597783-153597805 AGAGTTGCTCATTTTGAAATTGG - Intergenic
941251187 2:163165221-163165243 AGAGCTTGTCAGATTGAAGTGGG + Intergenic
946259284 2:218472274-218472296 AGACCTCTTCACAGTGAATTTGG - Intronic
946499505 2:220231341-220231363 AGAGCTGCTTGCTTTGAACTGGG + Intergenic
1168985460 20:2044676-2044698 AGAGAAGCTCACAGTGATTTTGG - Intergenic
1174683271 20:52428936-52428958 ATTTCTGCTCACATTGCATTGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177250154 21:18582250-18582272 AGAGCTGGAGACATGGAATTTGG - Intergenic
1180086810 21:45511234-45511256 AGAGCTGCTCACACGGCACTGGG - Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181602556 22:23961026-23961048 AGAGCTGCGCACCGTGGATTTGG - Exonic
1181605958 22:23980281-23980303 AGAGCTGCGCACCGTGGATTTGG + Exonic
1182794414 22:32980364-32980386 AGAGCTGCTCTGATGGAAATGGG - Intronic
1182844670 22:33420502-33420524 AGAGAGGCTCACATTTAAATAGG + Intronic
1183126570 22:35787421-35787443 AGGGATGCTGACATTTAATTAGG + Intronic
1183238740 22:36640035-36640057 AGAGCTGCTCACTTTTGATGTGG - Intronic
949597523 3:5563805-5563827 GGAGCTGCTCTTATTGAAGTGGG + Intergenic
951243633 3:20315578-20315600 AGAGCTGTTCACAGTAAAATGGG + Intergenic
951705933 3:25544607-25544629 AGAACTGCTCATCTGGAATTTGG + Intronic
953712860 3:45289526-45289548 AGAGATGCTCGCATTGCATGGGG - Intergenic
956052881 3:65267615-65267637 AGAGCTCTACACATTGAATTGGG - Intergenic
956106386 3:65822969-65822991 TGAGGTGCACACATTGTATTTGG - Intronic
956374090 3:68595530-68595552 AGAGGAGCTCACATTCAATTGGG - Intergenic
959234808 3:103706812-103706834 AGAACTGCTCACATTTTATAAGG + Intergenic
968607936 4:1544357-1544379 TGAGCTGCACACATTGACCTAGG - Intergenic
969128947 4:4976666-4976688 AGAGTTCATGACATTGAATTTGG - Intergenic
970315290 4:14823364-14823386 AAAGCTGTTTACTTTGAATTAGG - Intergenic
972309855 4:37870257-37870279 AGAGCTGCACACACTAAATGGGG - Intergenic
973101119 4:46272593-46272615 AGAGCAGCCCACCTTGAAATGGG + Intronic
973975150 4:56255867-56255889 AAAGCTGCTCATTTTGAATAGGG + Intronic
974827671 4:67151654-67151676 AGAGCTGGTCACCTTGAAGGGGG - Intergenic
979602605 4:122603114-122603136 GGAGCTGCTCACACTGAAGAAGG - Intergenic
984684304 4:182648667-182648689 AGTGCTGCTCACATTCTATCTGG - Intronic
990358411 5:54994255-54994277 AGAGCACTTCACATTCAATTAGG + Intronic
990483620 5:56236087-56236109 AGAACTGCAGTCATTGAATTGGG + Intergenic
991100445 5:62786129-62786151 AAAGCTAGTCACTTTGAATTGGG + Intergenic
992204667 5:74419833-74419855 ACAGCTGCTCAAAATGACTTAGG - Intergenic
996542106 5:124641240-124641262 AGAGCTGCTGACCTTGAAAAGGG + Exonic
996627225 5:125585215-125585237 AAAGCTGCTCTGATTGTATTTGG - Intergenic
997267457 5:132503371-132503393 AGAGGTGGTCACATTAGATTTGG + Intergenic
999096249 5:148980401-148980423 TGAGGAGCTCACATTGTATTGGG + Intronic
1003633949 6:7814173-7814195 AGAGCTGCTGAGATTCAATTAGG + Intronic
1003765502 6:9231697-9231719 ACACCTGCTTACATTGTATTGGG + Intergenic
1008323452 6:50147294-50147316 AGAACTGCTGACCTTCAATTTGG - Intergenic
1008448031 6:51616486-51616508 AGAGCTGCTCTCTTTGCTTTTGG + Exonic
1011171419 6:84508606-84508628 AAAGCTTCTCCCAGTGAATTAGG - Intergenic
1011535536 6:88372130-88372152 ATTGCTGCTCATATTCAATTTGG + Intergenic
1011700440 6:89950353-89950375 AAGACTGCTCACATTTAATTTGG + Exonic
1013985829 6:116192282-116192304 AGAGCTCCTCACTATGTATTAGG - Intronic
1016551958 6:145291643-145291665 AGAGGTTCACACATTGTATTAGG + Intergenic
1016865331 6:148760374-148760396 GGAGCTGCCCACAGTGAAATGGG - Intronic
1023323593 7:39027535-39027557 AGAGCTGCTCTGATTGGAATTGG - Intronic
1024038615 7:45531479-45531501 AAACTTCCTCACATTGAATTGGG + Intergenic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1030874917 7:114801698-114801720 TGAGATCCTCACATAGAATTGGG - Intergenic
1032330223 7:130971867-130971889 ATAGCTGCTGGCATTGGATTTGG - Intergenic
1033853002 7:145520518-145520540 AGAGCTGAACACAGTGAATCTGG + Intergenic
1034875750 7:154723527-154723549 ACAGCTGCTGAAATTAAATTAGG + Intronic
1034881841 7:154768551-154768573 AGAGCTGTTCACAATGAAATGGG + Intronic
1038450344 8:27635204-27635226 AGAGCTGCTCTGGTTGAAGTAGG - Intronic
1038503116 8:28062020-28062042 AGAACTGCTCTGGTTGAATTGGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040725223 8:50374705-50374727 TGAGCAGTTCACATTGATTTGGG - Intronic
1040946516 8:52890823-52890845 AGAGCTGTGCACATTAAATGAGG - Intergenic
1041149989 8:54922013-54922035 ACAGCTGTTTACATTGTATTAGG + Intergenic
1043162842 8:76868210-76868232 AAAGCTGCTTTCATTGTATTAGG + Intergenic
1046968034 8:120189294-120189316 AGAGCTGCTAACCTGGATTTAGG + Intronic
1048804821 8:138230246-138230268 AGGGCTGCTCCCCTTGAATGTGG - Intronic
1050301276 9:4261256-4261278 AGAGCTGCTCACATTGAATTGGG - Intronic
1051112605 9:13656398-13656420 AGAACTCCTGACATTGAATTGGG + Intergenic
1055654278 9:78437720-78437742 AGAACTGCTCACCTAGACTTAGG + Intergenic
1056902708 9:90614610-90614632 AGAGCTGGTCCCAGTGACTTGGG + Intronic
1060812390 9:126617123-126617145 AGAGCAGCACAAATTGAATGGGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186071470 X:5825972-5825994 AGAGCTGCCCTCATTGAGGTAGG + Intergenic
1188871353 X:35377218-35377240 AGAGCTGCTCATTATGAAGTGGG + Intergenic
1192468666 X:71377316-71377338 AGAGCTCTTCACACTGTATTAGG + Intronic
1193656726 X:84207297-84207319 AATGCAGCTGACATTGAATTGGG + Intergenic
1200076295 X:153552957-153552979 AGCGCTGGTCACACTGGATTGGG - Intronic
1200297053 X:154930745-154930767 AGAGATGCTAACTTTGAATAAGG + Exonic