ID: 1050301848

View in Genome Browser
Species Human (GRCh38)
Location 9:4266794-4266816
Sequence ATTCAACTTCACTACTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050301846_1050301848 30 Left 1050301846 9:4266741-4266763 CCTGATGCAATTCAAAGATTAGA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1050301848 9:4266794-4266816 ATTCAACTTCACTACTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050301848 Original CRISPR ATTCAACTTCACTACTGAAC AGG Intronic
No off target data available for this crispr