ID: 1050302987

View in Genome Browser
Species Human (GRCh38)
Location 9:4277625-4277647
Sequence CTGCTGTCCTTGGAGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050302987 Original CRISPR CTGCTGTCCTTGGAGACAAA GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900552108 1:3261977-3261999 CTGCTGCCCTTGGAGCTGAATGG + Intronic
901207013 1:7503215-7503237 CTGCTGCCCTTGGAGAGTCAGGG + Intronic
901928899 1:12584222-12584244 CAGATGTCCGTGGAGACAAGTGG + Intronic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
905749606 1:40450698-40450720 CTGCTGGCCAAGGAGACAGATGG + Exonic
906214183 1:44029788-44029810 CTGCGGTCCTTGGAAACACTTGG + Intronic
907415097 1:54308804-54308826 CTGCTTTCCTTGGTGATCAATGG - Intronic
907688031 1:56633229-56633251 ATGCTAGCCTTGGCGACAAATGG - Intronic
908820722 1:68083681-68083703 CAGCTGTCCTTGGACACATAAGG + Intergenic
908825825 1:68131826-68131848 CTGGTGTCCTTTGAAAGAAAAGG + Intronic
909039222 1:70629730-70629752 CTGCTGTCCTGGCAGCCAAGTGG + Intergenic
910206572 1:84754363-84754385 CTGCTGTCCTCGGTGTGAAAAGG + Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
916663782 1:166947539-166947561 CAGCTGGCTTTGGAGAAAAATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920200500 1:204257217-204257239 CTGCTGGTCCTGCAGACAAACGG + Intronic
922048962 1:221972340-221972362 TGGCTGTCCTTAGAGACAATAGG - Intergenic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
923497278 1:234536643-234536665 TTGCTGTCCCTGGAGACTTAGGG - Intergenic
924040217 1:239977327-239977349 CTGCTATCCTAAGAGACAGAAGG - Intergenic
1062821263 10:536261-536283 CTGGTGTCCTTGGAGAGGAAAGG - Intronic
1064532216 10:16322154-16322176 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
1066336097 10:34480061-34480083 CTGCAGTCCTTGCAGGCACAAGG + Intronic
1068234339 10:54213998-54214020 CTGCTGTCCTAGGATGCATATGG + Exonic
1068706572 10:60083089-60083111 CTTCTGTTCTTGGAGAGAGAAGG + Intronic
1069949528 10:72009530-72009552 CTGTGGTCCCTGGAGGCAAAAGG + Exonic
1072540895 10:96397251-96397273 CGGCTGTCCGTGGAGACGAGGGG + Exonic
1072551097 10:96478215-96478237 CTGCTGTCCTTGGGGGCCCAAGG - Intronic
1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG + Intronic
1075175353 10:120155587-120155609 CTGCTGTCTTTGGAGTCAGATGG + Intergenic
1075699434 10:124459622-124459644 CTACTGGCCTTGAATACAAAGGG - Intergenic
1075744330 10:124716093-124716115 CTGCTGTCCTTAGACAGAGAGGG + Intronic
1077294256 11:1817204-1817226 CTGCTGCTTTTCGAGACAAAAGG + Intergenic
1077463299 11:2721713-2721735 CTGCTGTCGGAAGAGACAAACGG - Intronic
1079210620 11:18457549-18457571 CTGCTGTCCTTAGTGCCATAAGG - Intronic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1080416098 11:32071187-32071209 CTCCTGTCCTTGGAGTTAAGGGG + Intronic
1080608064 11:33880956-33880978 TTTCTGTCCTTGGAGTCAAATGG - Intronic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083776811 11:64898029-64898051 GTGCTGTCCTGGGAGGCAGAAGG + Intronic
1084208233 11:67608380-67608402 GTGCTGTCTAGGGAGACAAAGGG - Exonic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087144684 11:94799989-94800011 CAGCTGTCCCTGGAGAGGAATGG + Exonic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088082892 11:105940765-105940787 ATGCTATCTTTAGAGACAAAAGG - Intronic
1089080443 11:115772191-115772213 CTGCTGACCTTGGTGACAGTAGG + Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089796907 11:120988092-120988114 CTGCCGTCCTGGGGGCCAAATGG + Exonic
1090901912 11:131039404-131039426 CTGCTGGCCTTGGATGGAAAGGG + Intergenic
1091104226 11:132903273-132903295 CTCCTGTCCTTGGTCACATATGG - Intronic
1091118126 11:133033959-133033981 TTACTGTTTTTGGAGACAAATGG - Intronic
1091829155 12:3536936-3536958 ATGCTGTCCTTAGTGACAAAAGG - Intronic
1092241255 12:6837717-6837739 TTGCTCTCCTAGGACACAAAGGG - Exonic
1092800819 12:12164404-12164426 CTGCTCTCCGTGAAAACAAAAGG + Exonic
1094394625 12:29992460-29992482 CTGCTGGCTTTGAAGACCAAGGG - Intergenic
1095193996 12:39290940-39290962 CTGCTGGTCTTGGAGTCAACAGG - Intergenic
1095279694 12:40335637-40335659 CTGTGGTCTTTGAAGACAAAAGG + Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098672190 12:73245913-73245935 CTGATGATCTTGGAGATAAAGGG - Intergenic
1099931549 12:89081334-89081356 ATTCTGTCCTTGGAGACATTTGG - Intergenic
1101030086 12:100649850-100649872 CTGCTGTACTAGGAAGCAAATGG - Intergenic
1101202404 12:102450456-102450478 CTGCTCCACTTGGAGACAAATGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101812491 12:108119998-108120020 CTGCTCTCATGGGAAACAAAGGG - Intergenic
1103177985 12:118881042-118881064 CATCTGGCTTTGGAGACAAAAGG + Intergenic
1105069735 12:133227264-133227286 CTGCTGTCCTTGGAGAGGTTAGG - Intronic
1107443605 13:40450013-40450035 CTGCTATACGTGGAAACAAAGGG + Intergenic
1109723932 13:66315055-66315077 TTGCTGGCTTTGAAGACAAAGGG + Intronic
1114488388 14:23079007-23079029 CTGCTGTCCCTGGAGACTCCAGG + Exonic
1115190198 14:30739634-30739656 CTTCTATCCTTGGAGATCAAAGG + Intergenic
1115272286 14:31566822-31566844 TTGCTGGCCTTGAAGACAGAAGG + Intronic
1115853217 14:37603594-37603616 CTGCTGTCTTTGGAGACGACAGG - Intronic
1119400512 14:74359261-74359283 CAGCTTTTCCTGGAGACAAAAGG + Exonic
1119914569 14:78385570-78385592 CTTCTGTCCCTGGAGAAATAAGG - Intronic
1120011005 14:79414161-79414183 ATGCTGTCCTTGGAGATCAGAGG + Intronic
1124508157 15:30296867-30296889 CTGCAGTCCAGGGAGACACAAGG - Intergenic
1124735398 15:32241789-32241811 CTGCAGTCCAGGGAGACACAAGG + Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127384041 15:58452975-58452997 CAGCTGTCCTTAGTGACAAATGG - Intronic
1127931399 15:63599814-63599836 CCGCTTTCCCTGGAAACAAACGG - Intronic
1128321609 15:66698586-66698608 CTGCTGTCCTTGGATTCCTAGGG - Intergenic
1129002156 15:72343941-72343963 CCCCTGTGCTTGGAGAGAAAGGG - Exonic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1129858508 15:78842043-78842065 CTGCTGTCCGAGGATACACAAGG + Intronic
1131131840 15:89905360-89905382 CTCCTATCCTTTGAGACAGAAGG - Intronic
1131661899 15:94526155-94526177 TTCCAGTCCTTGGAGAAAAACGG - Intergenic
1132126307 15:99228351-99228373 CTGCTGTGCTTGGAGCCTAGAGG + Intronic
1132485327 16:187354-187376 CTCCTTTCCTTGGAGACAGTTGG + Intergenic
1132657929 16:1049027-1049049 CTGCTGTCTTACGAGACAAAGGG + Intergenic
1133853989 16:9532466-9532488 CTGATTTCCCTGGACACAAAGGG - Intergenic
1134451596 16:14367381-14367403 CTGTTGTCCTTGGAGGCAAGGGG - Intergenic
1140758280 16:78088577-78088599 TTGCTGGCCTTGAAGACAGAAGG - Intergenic
1142107837 16:88315794-88315816 CTGGGGTCCTTGGAGGCCAAGGG + Intergenic
1142155805 16:88532444-88532466 CTGCTGTCCCGAGAGACAAAAGG + Intronic
1142514173 17:416219-416241 CTGCTCTCCATGGAGAGGAAGGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143165389 17:4894898-4894920 GTGCTGGACTTGGAGTCAAAAGG - Intronic
1143456726 17:7072675-7072697 CTGCAGTGCTTGGCCACAAAAGG - Intergenic
1144696113 17:17304916-17304938 CTGGTGTTGATGGAGACAAACGG - Intronic
1144765114 17:17728349-17728371 CTGATCTCCTTGGAGACCAGAGG - Intronic
1145110695 17:20158722-20158744 CTGCAGTCCTTGCAGATGAATGG + Intronic
1145777500 17:27539550-27539572 CCGTTGTCCTTGGAGTCCAACGG + Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1153992191 18:10410419-10410441 CTGATGTCCCTGTAAACAAACGG + Intergenic
1156770656 18:40718657-40718679 CTGCTGTGCTTGGATAGAGATGG + Intergenic
1156844342 18:41646773-41646795 CTGCTGTCCTTCCAGAAAATCGG + Intergenic
1157593136 18:48848120-48848142 ATGCTGACAGTGGAGACAAAGGG - Intronic
1158230792 18:55252198-55252220 CTGCTGCCCTTTGAACCAAATGG - Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1159938688 18:74388992-74389014 CTGCTTTCCTGGCAGAGAAATGG - Intergenic
1160354981 18:78219960-78219982 CTGGTGACCTTGGAGTTAAAAGG - Intergenic
1160474333 18:79168580-79168602 CTGATGTCCTGTGAGACAGAAGG - Intronic
1160596647 18:79980067-79980089 CTGGTGTCCTTAGAGGAAAATGG + Intronic
1161615104 19:5265723-5265745 CTGCTGCCCTGGGAGACACTGGG + Intronic
1166652223 19:44583092-44583114 CTGTTGTCCTGGGACACCAATGG - Intergenic
1168061726 19:53896870-53896892 GTGCTGTCCATGGTGACCAAGGG + Intronic
1168114983 19:54217402-54217424 CTCCAGTCCTAGGAGAGAAATGG - Exonic
925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG + Intergenic
925780366 2:7376382-7376404 CTGCTGTGCCTGCAGACCAAGGG + Intergenic
927085249 2:19668863-19668885 ATGCTGTGGTTGGAGAAAAAAGG + Intergenic
927435319 2:23061339-23061361 CTGCTGACCCCAGAGACAAAGGG - Intergenic
927785650 2:25972627-25972649 CTGGTGTCCTTGGGGACATGTGG + Intronic
928287825 2:30008776-30008798 CTAGTGTCTTTGGAGAAAAAGGG - Intergenic
928862943 2:35881692-35881714 CTGCTGTCATGAGAGATAAATGG + Intergenic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
931786005 2:65620033-65620055 ATCCTGTCCTGGGAGCCAAAGGG - Intergenic
931795961 2:65710444-65710466 CTGCTGTCCTGGGAAGCACATGG + Intergenic
931826580 2:66006597-66006619 CTGAAGGCCTTGGAGACAAGAGG + Intergenic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
932161694 2:69466032-69466054 ATACTGCTCTTGGAGACAAATGG + Intronic
933514373 2:83282216-83282238 CTGCTGTCTCCAGAGACAAAAGG + Intergenic
934552125 2:95269003-95269025 CTGCTGATCTTGGAGAGAGAGGG + Intergenic
936415576 2:112306823-112306845 CTGTTGTCTATGGAAACAAAAGG - Intronic
937717303 2:125047598-125047620 CTGATATCCTTGGACAGAAAAGG - Intergenic
939599417 2:144170406-144170428 CTGTGGGCCTTGGAGACCAAGGG - Intronic
940031152 2:149262838-149262860 CAGCTGTATTTGGAGATAAAAGG + Intergenic
942859451 2:180591509-180591531 CTGCTTTCCTTGGCTACAAAAGG + Intergenic
943528679 2:189051344-189051366 CTGGTGGCCCAGGAGACAAAGGG - Exonic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
944593544 2:201240173-201240195 TTTCTGTCCTTGTAGACAATGGG - Intronic
945096602 2:206225572-206225594 CTGTTGCACTTGGAGATAAAGGG + Intergenic
945295235 2:208163803-208163825 ATTATGACCTTGGAGACAAAGGG + Intergenic
946269321 2:218577369-218577391 CTGCTGTCATTCTAGCCAAAAGG - Intronic
947280282 2:228444843-228444865 ATTCTGTTCTTGGAGTCAAAAGG + Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948886639 2:240888192-240888214 CTGCTGACCTGGGAGAGAATGGG + Intronic
1169103991 20:2978573-2978595 CTTCTTTCCTTGAAAACAAAGGG - Intronic
1169637666 20:7710735-7710757 GTACTGTTCTTAGAGACAAAAGG + Intergenic
1170132979 20:13042724-13042746 TTGCTGAACTGGGAGACAAAGGG + Intronic
1170631562 20:18070887-18070909 ATGCTGTCCTAGGACACCAATGG - Intergenic
1173078301 20:39841930-39841952 CAGATGTGCTTGGAGAAAAAAGG + Intergenic
1173454363 20:43190838-43190860 CTGCTGTCCTGGGAGGCAGCTGG + Intergenic
1174055633 20:47796284-47796306 CTGCTGTCCTGGTAGAGAAGGGG + Intergenic
1174879820 20:54267060-54267082 CTGCTGCGCTTGAAGACACAAGG + Intergenic
1176069767 20:63219994-63220016 CTGGTGTCCATCGAGACAGATGG - Intergenic
1177654333 21:23998287-23998309 CTTGTGTCCATGGACACAAAGGG + Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1179314895 21:40234942-40234964 CTGCTATCATTGCAGACATAGGG - Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1184055257 22:42043257-42043279 GTGTGGTCCTTGGAGACAAGAGG + Intronic
1184089401 22:42284342-42284364 CTGCTGTGCTTGGAGACTGTGGG + Intronic
949118995 3:362806-362828 CTGCTGTCCTGGGAGAACATTGG - Intronic
951427361 3:22563299-22563321 CTGCTGGCTTTAGAGACAGAAGG + Intergenic
951683363 3:25317967-25317989 CTGCTGTTGTTGGAAACAACAGG + Intronic
951829716 3:26912583-26912605 TAGCTGCCCTTGGAGTCAAAGGG + Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953921617 3:46955791-46955813 CTGCTGTCCTTGGGGTGAGAAGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
955650773 3:61191706-61191728 CAGCTGCCCTTGGAGCTAAAGGG - Intronic
959932378 3:111998745-111998767 CTGCTGGCCTCGTAGACAATCGG + Exonic
960879195 3:122328003-122328025 CTGATGACATTGGAGCCAAAGGG - Intronic
960910736 3:122646676-122646698 CTGCTATTCTGGGAGCCAAATGG - Intergenic
961648121 3:128403459-128403481 CTGCCTGCCTTGGAGACACAGGG + Intronic
962697245 3:137962426-137962448 CACCAGTCCTTGGGGACAAAAGG + Intergenic
963969743 3:151416385-151416407 CTGCATTGCTTGGAGACCAAGGG - Exonic
964090510 3:152870892-152870914 ATGCTATCCTTGCAAACAAAAGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966143589 3:176785258-176785280 CTCCTATCCTTGGAGAGAAATGG - Intergenic
966902922 3:184500072-184500094 CAGCTGTCCTTGAACACGAATGG + Intronic
968845104 4:3036645-3036667 CTGCTGTCCTCAGAGGCAGAGGG - Intronic
970163648 4:13214338-13214360 TTGCTGACCTTGGAGAGAGAGGG - Intergenic
971511823 4:27435944-27435966 CATCTGTCCTTTGAGAAAAAGGG + Intergenic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
975580234 4:75900442-75900464 TTTTTGTCCTTGGTGACAAAAGG - Intronic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
975979562 4:80141583-80141605 CTCATGTCCTAGGAGATAAAGGG + Intergenic
976309083 4:83592171-83592193 CTGAGGTCCTTGGTTACAAATGG - Intronic
978506241 4:109460531-109460553 CTGCTGTCCTTTGCTACAAATGG - Intronic
979011014 4:115368476-115368498 GTACTGTGCTTGGAGACCAAAGG + Intergenic
979602757 4:122604388-122604410 CAGCTGTGCTTGGAGGCAAAGGG - Intergenic
982051814 4:151509527-151509549 CTTCTGCCCTTGGAGACCGAGGG + Intronic
983521457 4:168713402-168713424 CTGCTCTCCAGGGAGAGAAAGGG + Intronic
983568489 4:169179223-169179245 TTGCTGGCTTTGAAGACAAAAGG + Intronic
984115049 4:175669823-175669845 CTGCTGTCCTTATAAAAAAAGGG + Intronic
984552982 4:181182712-181182734 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
984757718 4:183339528-183339550 CTGCTGTGCTTGGAGAACAGAGG - Intergenic
985266903 4:188159256-188159278 CAGCGATCCTTGGAGAGAAAGGG - Intergenic
987348987 5:17004561-17004583 CTAATGTAGTTGGAGACAAAGGG - Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
991135524 5:63177474-63177496 CTACAATCCTTGGGGACAAATGG - Intergenic
991327353 5:65449867-65449889 CTTCTGTCATTTGAGGCAAAAGG + Intronic
992190163 5:74284301-74284323 GTGCTATCCTAGGAGACACATGG - Intergenic
994005897 5:94836848-94836870 CTGCTTTCCTGGGACACATATGG - Intronic
996094982 5:119389015-119389037 CTGCTGTCCGTGGAGATGGAGGG + Intronic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
998136796 5:139678327-139678349 CAGCTATCCTTGGACACACATGG + Intronic
998267181 5:140674862-140674884 CTGCTGTCCTCAGGGACAGAGGG + Intronic
998395490 5:141815221-141815243 CTGCTATGCTTGGAGCCATAAGG - Intergenic
999882413 5:155880903-155880925 CTGCTCACCTAGGAGTCAAATGG - Intronic
1000907996 5:166986816-166986838 CTGCAGCCATTGGTGACAAAAGG - Intergenic
1001155485 5:169269224-169269246 CTGCAGTCATTGGATCCAAAGGG - Intronic
1001293490 5:170483040-170483062 CATCTGTCCTTGGAAACAAAAGG - Intronic
1001450800 5:171822911-171822933 CTGCTTCCCTTGGAAACACAAGG + Intergenic
1001559860 5:172661925-172661947 CTTCTGTCCTTGGACACCAAGGG + Intronic
1001779373 5:174354678-174354700 TTTCTGTCCGTGGAGACAGATGG + Intergenic
1002037785 5:176486180-176486202 CGGCTGTACTTGGAGGCAACTGG - Intronic
1005637349 6:27764870-27764892 CTCCTGGCATTGGAGACCAAGGG + Intergenic
1006230041 6:32578735-32578757 TTTCTGTCTTTGGAGCCAAATGG + Intronic
1006364957 6:33609916-33609938 CAGCGGTCCTTGGAGATAACAGG - Intergenic
1006635856 6:35460658-35460680 CTGCAGTCCTTGGAAGCACACGG + Intronic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1010897818 6:81387167-81387189 CTTCTGGCCTTGGAGACTAAAGG - Intergenic
1011015120 6:82746064-82746086 CTGCTGTAGAAGGAGACAAAGGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012634056 6:101513372-101513394 TGGCTGTCCTTAGAGACAATAGG + Intronic
1013638691 6:112052869-112052891 CTGGTGTCCTTGGAGAACCATGG - Intergenic
1014042286 6:116842540-116842562 TTACTGTCTTTGAAGACAAATGG - Intergenic
1014099295 6:117492435-117492457 TGGGTATCCTTGGAGACAAAGGG - Intronic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014826657 6:126054832-126054854 CTGCTGTCTTCTGAGACACAGGG + Intergenic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1016525077 6:144992372-144992394 CTGCTCTCCTTGTAAACAAGAGG + Intergenic
1017173664 6:151481430-151481452 CTGTTGACCTTGTAAACAAAGGG - Intergenic
1018167099 6:161108395-161108417 CTGCTGTCTGTGGAGACATCCGG + Intronic
1018890631 6:167978955-167978977 TGGCTGCCCTTGGAGACAATAGG + Intergenic
1019099738 6:169619748-169619770 TGGCTGCCCTTGGAGACAACAGG + Intronic
1020582492 7:10021628-10021650 CTGTTACCCTTGGTGACAAAGGG + Intergenic
1023540299 7:41257531-41257553 CCACTGTCCTTTGAGACAATGGG + Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024878540 7:54056539-54056561 CTGTTTTCCTTTGAGAAAAATGG - Intergenic
1026739041 7:72967006-72967028 CTGGTGACCTTGGGGACACAGGG - Intronic
1026790060 7:73325638-73325660 CTGGTGACCTTGGGGACACAGGG - Intronic
1027104692 7:75398067-75398089 CTGGTGACCTTGGGGACACAGGG + Intronic
1027494003 7:78864920-78864942 CTCCTCTCCTTGAAGACATAGGG - Intronic
1027765816 7:82340029-82340051 CTGCTGGCTTTGAAGACCAAGGG + Intronic
1028246180 7:88480410-88480432 CTCCTGTCTTTGGATTCAAATGG + Intergenic
1031060422 7:117045380-117045402 CTGCTCTCCTTGGATACACCAGG + Intronic
1031436443 7:121737883-121737905 CTGATGTCTTTGGATACACAGGG - Intergenic
1033812346 7:145030771-145030793 CTGCGGTCCTAGGATACAGAAGG - Intergenic
1034115811 7:148582844-148582866 CTGCTGACCTTGAACACAAGAGG - Intergenic
1035777617 8:2200500-2200522 CTGCTGTCCTTGGTGACTGGAGG + Intergenic
1037536947 8:19833626-19833648 CTGTTGTACTTGGAAACACAAGG + Intronic
1039774235 8:40719894-40719916 TTGCTCTCCCTGGAGGCAAAGGG + Intronic
1039985753 8:42446346-42446368 CTGCTGTCAATGGTGACAACAGG + Intronic
1040494929 8:47958205-47958227 TTGCTGGCCTTGAAGACCAAGGG + Intronic
1042781283 8:72493868-72493890 CTGCTGTCCTCAGAGAGAACAGG - Intergenic
1043943866 8:86228215-86228237 GTGCTGTCATTGCAGACAAGGGG + Intronic
1045049450 8:98309527-98309549 CTGCTGTCTTTGGAGGAGAATGG - Intergenic
1046209057 8:111042588-111042610 CTGTCTTTCTTGGAGACAAAGGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049491777 8:142907944-142907966 CAGGTGTCCTTGGAGGAAAAGGG - Intronic
1050157797 9:2686134-2686156 CTGCACTCCTGGGAGACAAAGGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1053174725 9:35914530-35914552 CTCCTGCCCTTGGGGACAATAGG - Intergenic
1053206378 9:36190047-36190069 CTGCTGTCCTTAGGGAGGAAAGG + Intergenic
1053437559 9:38086588-38086610 AGGCTTTCCTTGGAGACAAGTGG + Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1055870720 9:80876060-80876082 CTATTGTACTTGGAGAAAAAGGG - Intergenic
1058196112 9:101978542-101978564 CTGCTGGCTTTGAAGACAGAAGG - Intergenic
1059568479 9:115408477-115408499 CTGATGTCCCTGGAGGCAGAGGG - Intergenic
1059710527 9:116863726-116863748 CTTCTTCCCTTGGAGAGAAAGGG + Exonic
1060293929 9:122330338-122330360 CTGCTGTCTTTGGAGATTTAGGG - Intergenic
1060680291 9:125556638-125556660 CTCCTCTACTGGGAGACAAATGG + Intronic
1060915716 9:127388984-127389006 GTGATGACCTTGGAGACTAAGGG - Exonic
1061074647 9:128333686-128333708 CTGCTTCCCTTGGAGGCAGAGGG + Exonic
1061943000 9:133893069-133893091 GTGCTGTCCTCTGAGAGAAAGGG - Intronic
1062067251 9:134535385-134535407 CTGCTGGCCTTGACGACGAAGGG - Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185713644 X:2324198-2324220 CTGTTCTCCTTGGAGGGAAATGG - Intronic
1186527020 X:10258064-10258086 CTGCCCTTCTTGGTGACAAAGGG + Intergenic
1188316739 X:28683807-28683829 CTGCTGGCTTTGAAGACAGAAGG - Intronic
1188327239 X:28820825-28820847 CAGCTGCCCTTGGAAACTAATGG + Intronic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1190385243 X:49878472-49878494 CAGCTGGCCTTGGAGAGAAGAGG + Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191624693 X:63257895-63257917 TGGCTGTCCTTAGAGACAATAGG + Intergenic
1191776898 X:64824179-64824201 ATGCTGTCATTGGAGACTACAGG + Intergenic
1192363995 X:70455772-70455794 CTGCAGCCCTAGGGGACAAAGGG - Intronic
1192677541 X:73214358-73214380 CTGCTGGGCTTGGAGACGATGGG - Exonic
1198920863 X:141724930-141724952 CTGATGTCCTTTGGGAGAAATGG - Intergenic
1199064475 X:143398571-143398593 TAGCTGTACTTGGAGACAGAAGG + Intergenic