ID: 1050303407

View in Genome Browser
Species Human (GRCh38)
Location 9:4282545-4282567
Sequence CTCTTCCTGGATCTTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050303404_1050303407 8 Left 1050303404 9:4282514-4282536 CCTTGCCTTTAACTTCAAACTGA 0: 1
1: 0
2: 1
3: 31
4: 216
Right 1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG No data
1050303403_1050303407 30 Left 1050303403 9:4282492-4282514 CCAACTGGGACACTGGCTTTTTC 0: 1
1: 1
2: 2
3: 26
4: 211
Right 1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG No data
1050303405_1050303407 3 Left 1050303405 9:4282519-4282541 CCTTTAACTTCAAACTGAAACAT 0: 1
1: 0
2: 5
3: 48
4: 395
Right 1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050303407 Original CRISPR CTCTTCCTGGATCTTGAGCC TGG Intronic
No off target data available for this crispr