ID: 1050303851

View in Genome Browser
Species Human (GRCh38)
Location 9:4286371-4286393
Sequence CCTGTGGGGTTCCCGATGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050303838_1050303851 30 Left 1050303838 9:4286318-4286340 CCCGGAGTGGGCTCGGATGGCAG 0: 1
1: 1
2: 1
3: 7
4: 170
Right 1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 89
1050303842_1050303851 -4 Left 1050303842 9:4286352-4286374 CCACTGACCATCCTAGGCCCCTG 0: 1
1: 0
2: 2
3: 21
4: 245
Right 1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 89
1050303839_1050303851 29 Left 1050303839 9:4286319-4286341 CCGGAGTGGGCTCGGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 194
Right 1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050303851 Original CRISPR CCTGTGGGGTTCCCGATGTC CGG Exonic
900130246 1:1084308-1084330 CCTGTGGGGTTTCCCATCTCTGG - Intronic
903175543 1:21578051-21578073 CCTGGGGGGTTCCAGAGGTAAGG - Exonic
906132969 1:43472358-43472380 CCTGAGGGGTTCCTTATTTCCGG - Intergenic
921219931 1:212966165-212966187 CCTGTGTGGTTCCTGGTGTGGGG + Intronic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
924757307 1:246953038-246953060 CCTCTGAGGTTCCCAATGGCTGG + Intronic
924801832 1:247333420-247333442 TCTGTGGGGTTCCAGAGCTCTGG + Intergenic
1065245158 10:23748748-23748770 CCTGTGAGGTTCATGCTGTCTGG + Intronic
1066196686 10:33106927-33106949 CCTCTGGGGCTCCAGAGGTCGGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067427630 10:46221644-46221666 CCTGTGGGCTTTCCAATGTCTGG + Intergenic
1067583051 10:47457557-47457579 CCTGTGGGCTTTCCAATGTCTGG + Intergenic
1069428972 10:68316138-68316160 CCTGAGGGAGTCCCAATGTCGGG + Intronic
1074410313 10:113222528-113222550 CTTCTGGGGCTCCAGATGTCTGG - Intergenic
1074754399 10:116613705-116613727 CCCCTGGGGTTCCCCATGCCAGG - Intergenic
1076616572 10:131759094-131759116 GCTGTGGGGCTCCTGAAGTCCGG - Intergenic
1077271531 11:1684348-1684370 CCTGTGGGCCTCTCGGTGTCTGG - Intergenic
1078896357 11:15600492-15600514 CATGAGGGGCTCCCGATATCAGG - Intergenic
1083661816 11:64254923-64254945 GCTTTGGGGGTCCCGATGCCCGG + Exonic
1084429194 11:69101921-69101943 GCTGTGGGGTTCCCGCTGGGTGG + Intergenic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1086035543 11:82409963-82409985 CCTGTGGGGTTCCTGCTCTAGGG - Intergenic
1088597500 11:111451046-111451068 ACTGTGGGGTTTCGGATGCCTGG - Intronic
1089745275 11:120612591-120612613 CATGTGGGATTCCCCATGACAGG + Intronic
1090804153 11:130192052-130192074 CCTGTGGGATACCCCACGTCAGG + Intronic
1094472700 12:30818172-30818194 CCAGTGGGCTTCCCGCTGACTGG - Intergenic
1095976953 12:47946502-47946524 CCTGAGGGCTGCCCGATGCCCGG - Intergenic
1104863312 12:131936936-131936958 CCTCTGGGGTGTCCTATGTCTGG - Intronic
1104919805 12:132284926-132284948 GCTCTGGGGTTCCCCATGTGTGG - Intronic
1104978508 12:132562567-132562589 CCTGTGCGGTCCCCGGGGTCGGG - Intronic
1105977200 13:25482504-25482526 CACATGGGGTTCCCCATGTCTGG - Intronic
1119420803 14:74506667-74506689 CCTGTGGGCTACCCAAGGTCTGG - Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1120150954 14:81033020-81033042 CCTTTGGTGTTCCCAATTTCTGG + Intronic
1121441546 14:93952950-93952972 CCTGTGCGGTTCCCGCTGCTTGG + Intronic
1124685865 15:31781429-31781451 CCTGTGTGGTCCATGATGTCTGG - Intronic
1127993076 15:64134877-64134899 CCTGTGGGGTTCCAAACCTCTGG - Intronic
1128302380 15:66574622-66574644 CCTGTGGGGAACCCCATGGCTGG + Intergenic
1130656999 15:85798720-85798742 CCTGTGGGCTTCCCCATCTCAGG + Intergenic
1131187480 15:90287296-90287318 CCTGTGCGGACCCCGGTGTCGGG + Intronic
1132567458 16:630048-630070 CCTCTGTGGCTCCAGATGTCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1141950208 16:87335008-87335030 CCTGTGGGGTTTAGGAAGTCTGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1144456921 17:15426462-15426484 GCTGTGGGGTTCCTGATATGGGG - Intergenic
1147635199 17:41959681-41959703 GCTGGGGGGTTCCCGGTGGCGGG + Intronic
1147863080 17:43535072-43535094 CCTGCGGGGTTCCCAAACTCTGG + Intronic
1148030041 17:44613351-44613373 CCTGTGGGGTGCTGGATGGCCGG + Intergenic
1148745414 17:49915333-49915355 CTTGTGGGGTACCCGGTGTTTGG + Intergenic
1150427571 17:65088634-65088656 GCTGTGTGGTTCCCCATCTCTGG + Intergenic
1152513416 17:80805574-80805596 TCTGTGGGCTTCCCGGTGTCAGG - Intronic
1152608588 17:81304908-81304930 CCTGTTGGGCTCCCGAGCTCTGG + Intergenic
1155170340 18:23262557-23262579 TCTGTGGGCTTCCTGATGTCGGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1167761663 19:51453803-51453825 CCTGTGAGCTTCCCCAGGTCAGG - Intronic
1168557917 19:57358889-57358911 CCTATGGGGTTCTGGATATCAGG - Exonic
925345585 2:3170006-3170028 CCTTTGGGGTTGGTGATGTCTGG + Intergenic
926460658 2:13125861-13125883 CCTCTGGGGTTCTGGACGTCTGG - Intergenic
931128358 2:59302775-59302797 GCTATGGGGTTCTCGATTTCAGG + Intergenic
939183688 2:138834484-138834506 CTGCTGGGGTTCCCAATGTCGGG - Intergenic
941117615 2:161489600-161489622 GCTCTGGAGTTCCCCATGTCAGG + Intronic
942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG + Intronic
945745444 2:213714876-213714898 GGGGTTGGGTTCCCGATGTCTGG - Intronic
948434658 2:237944829-237944851 CCTCTGTGGTTACCTATGTCTGG - Intergenic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1173983632 20:47244163-47244185 CCTTTGGGGTTTCCATTGTCTGG - Intronic
1174272311 20:49378551-49378573 CCTGTGGCATCCCCAATGTCTGG - Intronic
1175667267 20:60871115-60871137 CCAGTGGGGTTCCCCATGAACGG + Intergenic
1176299279 21:5090956-5090978 CCTGTGGTGCTCCCGAGGACGGG + Intergenic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1179857747 21:44170991-44171013 CCTGTGGTGCTCCCGAGGACGGG - Intergenic
1183520483 22:38293774-38293796 CCTGGGGGCTCCCTGATGTCAGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1185093091 22:48786783-48786805 CCTGTGGGTTTCCCGCTCCCAGG + Intronic
1185196116 22:49470568-49470590 CCTGTGGGGTTCCTGCTGTTTGG - Intronic
1185339439 22:50284935-50284957 GCTGTGGGGGCCACGATGTCAGG - Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
968423439 4:504579-504601 CCTGTGGCATTCCAGAAGTCTGG + Intronic
970570957 4:17382453-17382475 CCTGTGTTGTTCCTGATGACTGG - Intergenic
980960551 4:139470503-139470525 CCTTTGGGGTCCCAGATTTCAGG - Intronic
985587020 5:745730-745752 CCTGTGGGGTTCCCCACATCTGG + Intronic
985601588 5:837913-837935 CCTGTGGGGTTCCCCACATCTGG + Intronic
985727705 5:1524487-1524509 TCTGAGGGGATCCCGAGGTCTGG - Intergenic
985941820 5:3142416-3142438 CCTGTGGGCTGACCGTTGTCAGG - Intergenic
990505128 5:56436301-56436323 ACTGTGGGGTTCCAAATGTGAGG + Intergenic
990899958 5:60739358-60739380 GCTGTGGGGTCCCTGATGCCAGG + Intergenic
990939886 5:61191245-61191267 CTTGAGGAGTTCCTGATGTCAGG - Intergenic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1015864240 6:137711632-137711654 CATTTGTGGTTCCCTATGTCTGG - Intergenic
1019309231 7:352213-352235 CCTGTGGGGTGCCCGCCGTGTGG + Intergenic
1026914433 7:74111594-74111616 CCGGTGGGGGCCCCGATGGCAGG - Intronic
1041368114 8:57130708-57130730 GCTGTGGATTTCCCCATGTCTGG + Intergenic
1045889691 8:107140716-107140738 CCTTTGGGATTCCCCATGGCAGG + Intergenic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1057977489 9:99621699-99621721 TCTGTGGGGTTCCCAGTGCCTGG - Intergenic
1060278473 9:122199806-122199828 CCTGGGGGGTTCCCCAGGTGGGG - Intronic
1062596845 9:137303429-137303451 CCTGTGGGGAGCCGGATGTGGGG - Intergenic
1191221947 X:57998748-57998770 ACTATTGGGTTCCCGATTTCAGG + Intergenic