ID: 1050310121

View in Genome Browser
Species Human (GRCh38)
Location 9:4344207-4344229
Sequence CACCATTTTTATTTGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050310113_1050310121 27 Left 1050310113 9:4344157-4344179 CCCACTTCTCTGGTCCCCTTTAC 0: 1
1: 0
2: 12
3: 36
4: 344
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310118_1050310121 -5 Left 1050310118 9:4344189-4344211 CCCGATAAAATTCATATTCACCA 0: 1
1: 0
2: 2
3: 24
4: 254
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310114_1050310121 26 Left 1050310114 9:4344158-4344180 CCACTTCTCTGGTCCCCTTTACA 0: 1
1: 0
2: 9
3: 54
4: 361
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310119_1050310121 -6 Left 1050310119 9:4344190-4344212 CCGATAAAATTCATATTCACCAT 0: 1
1: 0
2: 1
3: 38
4: 302
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310115_1050310121 13 Left 1050310115 9:4344171-4344193 CCCCTTTACAGCAAGTCTCCCGA 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310117_1050310121 11 Left 1050310117 9:4344173-4344195 CCTTTACAGCAAGTCTCCCGATA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data
1050310116_1050310121 12 Left 1050310116 9:4344172-4344194 CCCTTTACAGCAAGTCTCCCGAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050310121 Original CRISPR CACCATTTTTATTTGCCCCA GGG Intronic
No off target data available for this crispr