ID: 1050313632

View in Genome Browser
Species Human (GRCh38)
Location 9:4378703-4378725
Sequence ATCCAGAGGCAGAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050313627_1050313632 19 Left 1050313627 9:4378661-4378683 CCACTATTCCTAATATGGACTAT No data
Right 1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG No data
1050313626_1050313632 20 Left 1050313626 9:4378660-4378682 CCCACTATTCCTAATATGGACTA No data
Right 1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG No data
1050313628_1050313632 11 Left 1050313628 9:4378669-4378691 CCTAATATGGACTATGTAGAGAA No data
Right 1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050313632 Original CRISPR ATCCAGAGGCAGAATGAGAA AGG Intergenic
No off target data available for this crispr