ID: 1050316906

View in Genome Browser
Species Human (GRCh38)
Location 9:4411721-4411743
Sequence GCTCCCAAAGAAATAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050316905_1050316906 23 Left 1050316905 9:4411675-4411697 CCTTAACTTCTCTTCTGCAACAA No data
Right 1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050316906 Original CRISPR GCTCCCAAAGAAATAACCCA TGG Intergenic
No off target data available for this crispr