ID: 1050318072

View in Genome Browser
Species Human (GRCh38)
Location 9:4423448-4423470
Sequence TTTTCTAAAGGTCTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050318072_1050318082 23 Left 1050318072 9:4423448-4423470 CCCTCCCCCAGACCTTTAGAAAA No data
Right 1050318082 9:4423494-4423516 ATGACACCAAAGCTCCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050318072 Original CRISPR TTTTCTAAAGGTCTGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr