ID: 1050326593

View in Genome Browser
Species Human (GRCh38)
Location 9:4503886-4503908
Sequence GTGGGCTTCTAGGGGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050326593_1050326599 12 Left 1050326593 9:4503886-4503908 CCATTGATCCCCTAGAAGCCCAC 0: 1
1: 0
2: 0
3: 10
4: 72
Right 1050326599 9:4503921-4503943 GTTTTTGAGTGAAGACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050326593 Original CRISPR GTGGGCTTCTAGGGGATCAA TGG (reversed) Intronic
901653262 1:10755163-10755185 GTGGGCAGCAAGGGGATCACTGG + Intronic
902133721 1:14285915-14285937 GTGGGCTTCTAAGCAATCACAGG + Intergenic
902502825 1:16922150-16922172 GTGTGCGTCTTGGGGATCAAGGG + Intronic
903274689 1:22212982-22213004 GTGGGATTCCAGGGGATCAGTGG + Intergenic
912228962 1:107770031-107770053 GTGGGCTTCTAGGCCATGCAAGG - Intronic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
920748205 1:208648879-208648901 GTGGGCTTCTTGGGGCTATAGGG + Intergenic
924209974 1:241754707-241754729 GTGGGGGGCTAGGGGAGCAATGG - Intronic
1073289261 10:102405301-102405323 GCGGGCGTCTAGGGGATGGATGG - Intronic
1073783798 10:106866303-106866325 GTGGGGTTGGAGGGGATCCATGG - Intronic
1074432538 10:113406134-113406156 GTTGGCTTCAAGGTGATCACAGG - Intergenic
1080274450 11:30487835-30487857 GTGTGCTTCTAGGGGAAAATAGG - Intronic
1081223268 11:40489306-40489328 GTTAGCTTTTAGGGGAGCAAGGG - Intronic
1082145564 11:48663659-48663681 TTGGAGCTCTAGGGGATCAATGG + Intergenic
1082826456 11:57583381-57583403 GTTGGCTTTTCGGGGACCAATGG - Intergenic
1086446570 11:86877206-86877228 GTGAGCTCCTTGGGGGTCAAGGG + Intronic
1091900452 12:4140360-4140382 ATGGGCCTATAGGAGATCAAGGG - Intergenic
1095390677 12:41702675-41702697 GTAGGCTCCTTGGGGATCTAAGG - Intergenic
1097538413 12:60903176-60903198 TTGGCTTTCTAGGGGGTCAAAGG + Intergenic
1102021473 12:109686450-109686472 GTGGGCTTCTTGGGGGTCCATGG + Intergenic
1102046271 12:109832255-109832277 GTGGGCTTTTGGGGGAACAAGGG - Intronic
1103860676 12:124010762-124010784 GTGGGCTTTAAAGGAATCAAAGG + Intronic
1106759274 13:32851701-32851723 GTGGGATTATAGAGGTTCAAAGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1109849341 13:68039774-68039796 GTGGACTTTTGGGGGATCATGGG - Intergenic
1113972651 13:114201555-114201577 GTGGGCTTCCAGGGCTTCAAGGG + Intergenic
1134219624 16:12343670-12343692 GTGGGGATCTAGGTGGTCAACGG - Intronic
1134415982 16:14043786-14043808 GTGGGCATGTAGGAGATCATAGG - Intergenic
1136068962 16:27776763-27776785 ATGGGCTTCGAGGAGATGAAAGG + Intronic
1137575003 16:49593713-49593735 GGGGGCTTCTCGGAGATCTAAGG - Intronic
1139223177 16:65205786-65205808 GTGGTCTTCTAAGGGCTCCAGGG + Intergenic
1140475723 16:75238461-75238483 GAGGGCCTCTAGGGGTTCAGGGG - Intronic
1144189657 17:12832920-12832942 TTGGGCTTCTAGCAGAACAAGGG - Intronic
1148553385 17:48564043-48564065 GGGGGCTTCAAGGGGGTAAAGGG - Intronic
1152007763 17:77693334-77693356 GTGGGCTTCTGGCAGATCAAGGG - Intergenic
1157040819 18:44036821-44036843 GTTGGCTTTTAGGAGATCAAAGG - Intergenic
1164617191 19:29674281-29674303 GTGGCCTTGTCGGGGATCCAGGG - Exonic
1166901784 19:46069587-46069609 GTGGGCTTTTAGGGCTTCAAGGG - Intronic
1167399572 19:49255890-49255912 GTGGGCTCCTAGGGGAAAATGGG - Intergenic
1167548809 19:50145365-50145387 GCGGGATTCAAAGGGATCAAGGG - Intergenic
927852950 2:26511210-26511232 GGGGGCCTCTAGGGGAACAGTGG + Intronic
928650263 2:33396590-33396612 AAGGGCTCCCAGGGGATCAAAGG - Intronic
932438094 2:71715059-71715081 GTGGACATCCAGGGGAACAATGG - Intergenic
935686652 2:105689369-105689391 GTGGGCTTCTAGGAGCTCTCTGG - Intergenic
936745900 2:115576010-115576032 GAGGCCTTCTAGGGGCTCTAAGG - Intronic
942220714 2:173766483-173766505 GTGGTCTTCTTGGGTATCATGGG - Intergenic
944608869 2:201379899-201379921 TTGGGCTCCCAGGGGCTCAAAGG + Exonic
946642777 2:221802139-221802161 GTGAAGTTCTAGGGAATCAAAGG + Intergenic
1170726149 20:18928635-18928657 TTGGGCTATTAGGGGATCAGTGG + Intergenic
1172645381 20:36465890-36465912 GTGGGCCTCTAGGGGAAGAGAGG - Intronic
1180088789 21:45523532-45523554 GTGGGCTTCTAAGGGCCCATGGG - Intronic
1183073365 22:35411520-35411542 GTGGGAGTCTAGGGGATGAGGGG + Intronic
950962343 3:17119436-17119458 CTGGGATTCTGGGGGATCTAGGG - Intergenic
956072788 3:65472237-65472259 GTTGGCTTCTAGAGAATTAAAGG - Intronic
956742935 3:72289166-72289188 CTGGGCTGCTGGGGGCTCAAGGG + Intergenic
960397543 3:117155672-117155694 GTGGAGACCTAGGGGATCAAAGG + Intergenic
961523375 3:127481223-127481245 TTGGGCTTCAAGGGGCTCCATGG - Intergenic
965518682 3:169650622-169650644 TTTGGCTTCTGGAGGATCAAGGG - Intronic
966472655 3:180308851-180308873 GTGGGCTATTTGGGAATCAATGG + Intergenic
969467157 4:7364484-7364506 GTGGGCTTCGGGGGCTTCAATGG + Intronic
977606262 4:98988050-98988072 GTGGTCTTCTATAGGATCAATGG + Intergenic
978763230 4:112378024-112378046 GTGGATTTCTAGGGCATGAATGG + Intronic
987237275 5:15955543-15955565 GTGGCCTTGAAGAGGATCAAGGG + Intergenic
992956248 5:81911544-81911566 ATGTGCTGCTAGGGGAGCAAGGG - Intergenic
995371834 5:111427325-111427347 GGTGGCTTTTCGGGGATCAAGGG - Intronic
999772890 5:154788636-154788658 GTGGGTTTCTGGGGGAGGAAGGG + Intronic
1002442181 5:179270230-179270252 GTGGGCTTCTCGGGGAAAACAGG + Intronic
1005953769 6:30649484-30649506 TTGAGCATCCAGGGGATCAAGGG + Intronic
1009243356 6:61204876-61204898 GTGGGCTTCAGGGGGAGAAAGGG + Intergenic
1026428330 7:70318679-70318701 GAGGGCTTCTAGAGGCCCAAGGG + Intronic
1035335177 7:158123435-158123457 GTGGGCGTGCAGGGGATCCAGGG - Intronic
1041830514 8:62147885-62147907 GTGGGCTGCTATGGGTCCAAAGG + Intergenic
1047410527 8:124621034-124621056 GAGGGATTCCAGGGGATCATAGG - Intronic
1047953241 8:129953126-129953148 CTTGTCTTCTAGGGGATGAAAGG + Intronic
1050326593 9:4503886-4503908 GTGGGCTTCTAGGGGATCAATGG - Intronic
1050560545 9:6830430-6830452 GTGGGCTTTTGGGGGGTCACTGG + Intronic
1052699127 9:31916321-31916343 GTTGGCTTCTACGGGAATAAGGG - Intergenic
1060755826 9:126212693-126212715 GTAGGTCTCTAGGGGGTCAAAGG + Intergenic
1061659548 9:132119782-132119804 TTGGGCTTCTATGGGACCCAAGG - Intergenic
1190681418 X:52830074-52830096 GTGGGCTTCTGGAGGGTCACCGG - Intergenic
1190704361 X:53014140-53014162 GTGAGCTTTTAGGGGACCAAGGG - Intergenic
1202340234 Y:23856560-23856582 GTGGTCTTCAAGGGGATAGAAGG - Intergenic
1202530532 Y:25813522-25813544 GTGGTCTTCAAGGGGATAGAAGG + Intergenic