ID: 1050326919

View in Genome Browser
Species Human (GRCh38)
Location 9:4506882-4506904
Sequence TTTCCATGAGGGCAGTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050326914_1050326919 1 Left 1050326914 9:4506858-4506880 CCTCATTTCCCAGGGAACATCTG 0: 1
1: 0
2: 1
3: 45
4: 492
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326912_1050326919 3 Left 1050326912 9:4506856-4506878 CCCCTCATTTCCCAGGGAACATC 0: 1
1: 0
2: 1
3: 20
4: 191
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326908_1050326919 16 Left 1050326908 9:4506843-4506865 CCTCTTAGAACCTCCCCTCATTT 0: 1
1: 0
2: 2
3: 19
4: 174
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326907_1050326919 17 Left 1050326907 9:4506842-4506864 CCCTCTTAGAACCTCCCCTCATT 0: 1
1: 0
2: 6
3: 47
4: 274
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326911_1050326919 6 Left 1050326911 9:4506853-4506875 CCTCCCCTCATTTCCCAGGGAAC 0: 1
1: 0
2: 3
3: 28
4: 288
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326916_1050326919 -8 Left 1050326916 9:4506867-4506889 CCAGGGAACATCTGTTTTCCATG 0: 1
1: 0
2: 2
3: 39
4: 390
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326915_1050326919 -7 Left 1050326915 9:4506866-4506888 CCCAGGGAACATCTGTTTTCCAT 0: 1
1: 0
2: 3
3: 30
4: 252
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326913_1050326919 2 Left 1050326913 9:4506857-4506879 CCCTCATTTCCCAGGGAACATCT 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data
1050326906_1050326919 18 Left 1050326906 9:4506841-4506863 CCCCTCTTAGAACCTCCCCTCAT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050326919 Original CRISPR TTTCCATGAGGGCAGTACTA AGG Intronic
No off target data available for this crispr