ID: 1050332410

View in Genome Browser
Species Human (GRCh38)
Location 9:4558586-4558608
Sequence CTTGTACTCCAGGACTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050332410_1050332413 -4 Left 1050332410 9:4558586-4558608 CCAGCTGAGTCCTGGAGTACAAG 0: 1
1: 0
2: 2
3: 13
4: 298
Right 1050332413 9:4558605-4558627 CAAGCAGAGGCACCAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050332410 Original CRISPR CTTGTACTCCAGGACTCAGC TGG (reversed) Intronic
901742463 1:11351219-11351241 CTTGAACTCCAGGCCTCATGTGG + Intergenic
902294221 1:15455426-15455448 CTTGAACTCCTGGCCTCAGGTGG + Intergenic
902297055 1:15474837-15474859 CTTGAACTCCTGGCCTCAGGTGG + Intronic
905285387 1:36876270-36876292 CTTGAACTCCAGGGCTCAAACGG - Intronic
905359221 1:37407159-37407181 CTTGAACTCCTGGACTCAAGTGG - Intergenic
905629135 1:39509146-39509168 CTTGTGCCCCAGGGCACAGCAGG - Intronic
906266381 1:44433741-44433763 CTTGAACTCCTGGCCTCAGGAGG - Intronic
907313458 1:53552978-53553000 CACGTGCTCCAGGAATCAGCTGG + Intronic
907334317 1:53690356-53690378 CCTGTGCTGCAGGACACAGCTGG + Intronic
909749624 1:79142811-79142833 CTTGAACTCCTGGCCTCAACTGG - Intergenic
910513576 1:88034989-88035011 CATGTGGTTCAGGACTCAGCAGG - Intergenic
910561006 1:88590790-88590812 CTTGTCCTCCTGGACACAGGTGG - Intergenic
911037675 1:93567684-93567706 CTTGTACTCCACTCCCCAGCGGG + Intronic
912972196 1:114293990-114294012 CTTCTACTCTAGTACCCAGCAGG - Intergenic
913278144 1:117158944-117158966 CCTTTACTCCAGTTCTCAGCAGG + Intronic
915662061 1:157412778-157412800 CTTGTCCTCCAGGCTTCACCAGG - Intergenic
918076862 1:181177133-181177155 CCTGAAATCCAGGAGTCAGCAGG - Intergenic
918586953 1:186199359-186199381 CTTGGACTCCTGGCCTCAACTGG + Intergenic
918986850 1:191641524-191641546 CTTGTATTTGATGACTCAGCTGG + Intergenic
919834115 1:201562087-201562109 CTTGAACTCCTGGGCTCAGGCGG + Intergenic
920450880 1:206060428-206060450 CTAACACTGCAGGACTCAGCAGG + Intronic
920786269 1:209044741-209044763 CTTGGAATCCTGGATTCAGCTGG + Intergenic
920934638 1:210419566-210419588 CTTGTACTCTTGCCCTCAGCAGG - Intronic
921150602 1:212399544-212399566 CTTGAACTCCTGGACTCAAGTGG + Intronic
921507925 1:215996128-215996150 CTTGAACTCCTGGCCTCAACTGG + Intronic
922338349 1:224635784-224635806 CTTGAACTCCTGGGCTCAACTGG + Intronic
923683328 1:236136921-236136943 CTTGAACTCCTGACCTCAGCTGG - Intergenic
924150038 1:241120563-241120585 CTCGAACTCCTGGACTCAGGTGG + Intronic
924547651 1:245045227-245045249 CTTGAACTCCTGGACACAGGTGG + Intronic
924738773 1:246782286-246782308 CTTGAACTCCTGGGCTCAGGCGG + Intergenic
1065317922 10:24482798-24482820 CTTGAACTCCAGGGCTCAAGTGG - Intronic
1066261172 10:33730972-33730994 CTTGAACTCCCGGACTCAAGTGG - Intergenic
1067385751 10:45816651-45816673 CTCGAACTCCTGGCCTCAGCTGG + Intronic
1067385945 10:45817738-45817760 CCTGGTCTCCAGGTCTCAGCTGG - Intergenic
1070862301 10:79683087-79683109 ACTGCCCTCCAGGACTCAGCTGG + Intergenic
1071489637 10:86127596-86127618 CTTGTGGTCCAGCACTCAGCTGG - Intronic
1072270591 10:93772853-93772875 CTTGAACTCCTGGACTCAAGTGG - Intronic
1072451192 10:95541031-95541053 CTTGTTCTCCTGGAGTGAGCAGG - Intronic
1072463218 10:95639243-95639265 CCTGAACTCCAGGGCTCAGTTGG - Intronic
1074557786 10:114507881-114507903 CCTTTACTCCAGAACTCAGGGGG - Intronic
1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG + Intergenic
1077790001 11:5429057-5429079 CTTGTAACTCATGACTCAGCTGG + Intronic
1078407869 11:11087005-11087027 CTTGTACTCCAGACCTCAGCAGG + Intergenic
1079216488 11:18517229-18517251 CTTGAACTCCTGGACTCAAATGG + Intronic
1079225550 11:18601627-18601649 CTTGAACTCCAGGCCTCAAGTGG + Intergenic
1079247162 11:18761095-18761117 CTTGCAGTGCAGGACTGAGCAGG + Intronic
1079633070 11:22701607-22701629 CTTGAACTCCTGAACTCAGGTGG - Intronic
1079697183 11:23496291-23496313 CTGGACCTCCAGGACTCACCTGG + Intergenic
1080533845 11:33202791-33202813 TTTATCCTCCAGGACTCATCTGG - Intergenic
1081898085 11:46604290-46604312 CTTGAACTCCGGGCCTCAGTTGG - Intronic
1084055609 11:66630360-66630382 CTTGAACTCCTGGACTCAAAAGG - Intronic
1084542099 11:69793165-69793187 CTCGTCCTCCAGGGCCCAGCAGG + Intergenic
1084940190 11:72608320-72608342 CATGTATTCCAAAACTCAGCTGG + Intronic
1085920197 11:80945502-80945524 CTTGTATTCCAGGACTCACCTGG + Intergenic
1086299380 11:85409265-85409287 CATGTAAACCAGGACTCAGAAGG - Intronic
1088212720 11:107474297-107474319 ATTGTAAGCCAGGGCTCAGCTGG - Intergenic
1088375175 11:109132987-109133009 CTTGTACCCCAGCCCTCAACGGG - Intergenic
1088436337 11:109817185-109817207 CTTAAGATCCAGGACTCAGCAGG - Intergenic
1088987240 11:114920063-114920085 CTCTTTCTCCAGGACTCAGAAGG + Intergenic
1090413031 11:126521961-126521983 CTTGAACTCCTGGACTTAGGCGG + Intronic
1092805450 12:12218251-12218273 CTTGAACTCCTGGACTCAAGTGG - Intronic
1092844776 12:12574060-12574082 CTTGAACTCCAGGCCTCAAGTGG - Intergenic
1093337925 12:17932291-17932313 CTTACACTCAAGGTCTCAGCAGG - Intergenic
1095887585 12:47205277-47205299 CCTGTACTCCATGGATCAGCTGG - Intronic
1097120837 12:56730587-56730609 CTTGAACTCCTGGCCTCAGTCGG + Intronic
1097273401 12:57793764-57793786 CATATACTCAAGTACTCAGCTGG - Intronic
1100531131 12:95462636-95462658 CTTGAACTCCTGGACTCTCCTGG + Intergenic
1103574787 12:121869414-121869436 CTTGAACTCCTGGGCTCAGGGGG + Intergenic
1103578310 12:121895257-121895279 CTTGAACTCCTGGACTCAAGTGG + Intronic
1107470603 13:40687938-40687960 CCTGTCCTCCAAGACTAAGCTGG - Intergenic
1108854575 13:54776468-54776490 CTTGAACTCCTGGACTCAAGTGG + Intergenic
1108959926 13:56214201-56214223 CTTGGTCTCCTGGAGTCAGCGGG + Intergenic
1110710033 13:78640577-78640599 CTTGAACTCCTGACCTCAGCTGG - Intronic
1111315017 13:86544363-86544385 CTTGAACTCCTGAACTCAGGTGG + Intergenic
1116039843 14:39672649-39672671 CTTGCGCTCCTGCACTCAGCTGG - Intergenic
1117495010 14:56294224-56294246 CTTGTCATCCAGGTCTCACCTGG - Intronic
1118644220 14:67821266-67821288 CTTGTACCCCAGACCTCAGCAGG + Intronic
1119288183 14:73473305-73473327 CTTGAACTCCTGGGCTCAGCTGG + Intergenic
1119428226 14:74549844-74549866 CTTGGACTCCAGCACTCACCTGG + Exonic
1119650836 14:76381650-76381672 CTGGTGCTCCTGGGCTCAGCGGG + Intronic
1121925850 14:97926779-97926801 CTGGGACTCCAGGCCTCAGCAGG + Intronic
1122037760 14:98960953-98960975 CTTCTCCTCCAGGACAGAGCAGG + Intergenic
1122755427 14:103974989-103975011 CTTGTACTCCTGGGCTCAAGTGG + Intronic
1124641005 15:31396623-31396645 CCTGTACTCCATGGATCAGCTGG - Intronic
1126602725 15:50444975-50444997 CTTGAACTCCTGGGCTCAGGTGG + Intronic
1127988153 15:64091263-64091285 CTTGAACTCCTGAACTCAGGTGG - Intronic
1129195835 15:73965668-73965690 CTTGAACTCCAGGGCTCAAAGGG - Intergenic
1130192249 15:81748573-81748595 CTTGTACTCAGGGTCTTAGCAGG - Intergenic
1130195934 15:81780395-81780417 CCTGTACTCGATGAATCAGCTGG + Intergenic
1131254846 15:90855254-90855276 TCTGGACTCCAGGAGTCAGCTGG - Intergenic
1132091624 15:98952095-98952117 CTTTTACTCTAGGGCACAGCAGG - Intronic
1132710975 16:1267298-1267320 CTTGAACTCCTGGCCTCAGGCGG - Intergenic
1133812990 16:9175718-9175740 CTGGAACTCCTGAACTCAGCTGG + Intergenic
1135500496 16:22991776-22991798 CTCTTGCTCCAGGAATCAGCAGG + Intergenic
1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG + Exonic
1137650912 16:50119523-50119545 CTTGTACTCCTGGGCTCAGGTGG - Intergenic
1137657028 16:50168863-50168885 CTTGAACTCCTGGCCTCAGGTGG + Intronic
1139451974 16:67035302-67035324 CTTGTACTCCTGACCTCAGATGG + Intronic
1139785551 16:69389345-69389367 CTTGAACTCCTGAACTCAGGTGG - Intronic
1140959989 16:79902520-79902542 CTTATGTGCCAGGACTCAGCTGG + Intergenic
1141432961 16:83980431-83980453 CAGGAACTCCAGGACCCAGCAGG + Intronic
1142049472 16:87948750-87948772 CTTGAACTCCTGGACTCAAGCGG - Intergenic
1142593408 17:1017820-1017842 CTTGAACTCCAGACCTCAGGTGG + Intronic
1142628303 17:1206474-1206496 CTTGGACTCCAGGGCTCAAGCGG + Intronic
1142638409 17:1271371-1271393 CTTCCACGCCAGGTCTCAGCCGG - Exonic
1143130395 17:4673664-4673686 CTTCTTCCCCAGGCCTCAGCCGG - Exonic
1143534905 17:7532226-7532248 CTTGAACTCCTGGACTCAAGTGG - Intergenic
1146840610 17:36150692-36150714 CTTGAACTCCTGGGCTCAACTGG - Intergenic
1147710800 17:42462830-42462852 CTTGAACTCCTGGACTCAAGCGG + Intronic
1147957300 17:44143155-44143177 CTTGAACTCCTGGCCTCAGGTGG + Intronic
1148200900 17:45749456-45749478 CCGGAACTGCAGGACTCAGCAGG + Intergenic
1150913191 17:69410396-69410418 CTTGTCCTTGAAGACTCAGCGGG - Intergenic
1151906419 17:77052314-77052336 CTTGAACTCCTGGCCTCAGGTGG - Intergenic
1152569208 17:81114190-81114212 CTTGAACTCCAGGGCTCAAGTGG + Intronic
1152727965 17:81956954-81956976 CTTGTTGTCCAGGAACCAGCCGG + Exonic
1152765106 17:82132674-82132696 CTTGTAATCCCAGACTCAGGAGG - Intronic
1153311328 18:3679903-3679925 CTTGAACTCCTGGACTCAAATGG + Intronic
1154199054 18:12287034-12287056 CTTGAACTCCTGGCCTCAGCTGG + Intergenic
1155285683 18:24286844-24286866 CTTTTTCTCCAGCACTTAGCTGG - Intronic
1156369943 18:36464456-36464478 CTTGGACTCCAGCACCCAGGAGG + Intronic
1156514371 18:37667785-37667807 CTTGTTTTCCAGGGTTCAGCTGG + Intergenic
1156544082 18:37946419-37946441 CTTCTACTCCCTGACTCACCAGG - Intergenic
1158215713 18:55098524-55098546 CTTGAACTCCTGGACTCAAGTGG + Intergenic
1161954402 19:7485070-7485092 CTTGAACTCCTGGGCTCAGGTGG - Intronic
1162690457 19:12425809-12425831 CTTGAACTCCAGGCCTCGGTTGG + Intronic
1162748209 19:12811388-12811410 CTTGAACTCGAGGACTCAAGCGG - Intronic
1163065969 19:14795596-14795618 CCTGTACTCCATTGCTCAGCTGG - Intronic
1163523427 19:17805880-17805902 CTTGAACTCCTGGGCTCAGGTGG + Intronic
1164241526 19:23393778-23393800 CTCGAACTCCTGGCCTCAGCTGG - Intronic
1166128389 19:40730514-40730536 CTTGAACTCCTGGGCTCAGGCGG + Intronic
1166227964 19:41408824-41408846 CTTGAACTCCTGGGCTCACCTGG + Intronic
1166751832 19:45167777-45167799 CTCGAACTCCTGGACTCAGCTGG - Intronic
1167582832 19:50356552-50356574 CTTGAACTCCAGACCTCAGGTGG - Intronic
1167859660 19:52272549-52272571 CTTGAACTCCCGGGCTCAGGAGG + Intronic
1168394144 19:56033987-56034009 CTTGAACTCCTGGGCTCAGGTGG + Intronic
925547247 2:5030172-5030194 CTTGCATTCCAGGATTAAGCAGG + Intergenic
927768655 2:25837895-25837917 CTTGAACTCCTGGACTCAAGTGG - Intronic
931305328 2:61022781-61022803 CTTGAACTCCTGGACTCAAAGGG - Intronic
931449519 2:62356624-62356646 CTTGAACTCCAGGGCTCAAGTGG + Intergenic
931733053 2:65170081-65170103 CTTGAACTCCTGAACTCAGGTGG - Intergenic
931999090 2:67867180-67867202 CTTGAACTCCTGGGCTCAGGAGG - Intergenic
933994297 2:87656477-87656499 CTTGAACTCCTGGGCTCAGGAGG - Intergenic
935265592 2:101391014-101391036 CTTGAACTCCCGGACTCACATGG + Intergenic
935931063 2:108126136-108126158 CTTGTACTCTTGGACTCAAGCGG - Intergenic
936299564 2:111294436-111294458 CTTGAACTCCTGGGCTCAGGAGG + Intergenic
936328812 2:111529230-111529252 CATGTCCTCCAGGACCCTGCTGG + Intergenic
938218315 2:129542622-129542644 CTTGTTCTCCATGACTTAGATGG - Intergenic
940671591 2:156676240-156676262 CTTCTACTCTAGGACTCACACGG - Intergenic
943326403 2:186503595-186503617 CTTGAACTCCTGACCTCAGCAGG + Intronic
943688447 2:190843718-190843740 GTTATTCTCCAGGACCCAGCTGG - Intergenic
944325595 2:198400219-198400241 CATGGACTCCAGTAATCAGCAGG + Intronic
945172633 2:207012658-207012680 CCTGTACTCCATGGTTCAGCTGG - Intergenic
946283327 2:218682810-218682832 CTTGAACTCCTGGACTCAAGTGG + Intronic
946496495 2:220200921-220200943 CTTCTACTCCAGGTTTCTGCTGG - Intergenic
1172300313 20:33845276-33845298 CTTGTTCACCATCACTCAGCAGG + Intronic
1174001984 20:47381482-47381504 CTTGAACTCCTGGACTCAATTGG - Intergenic
1174009872 20:47441046-47441068 CTTGAACTCCTGGACTCAAGTGG + Intergenic
1174245202 20:49174498-49174520 CTTGAACTCCGGGTCTCAGGTGG - Intronic
1174459427 20:50672316-50672338 CTTTTACTGTAGGACTCTGCTGG - Intronic
1174609606 20:51788392-51788414 CTCAAACTCCTGGACTCAGCTGG + Intronic
1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG + Intronic
1174764733 20:53242347-53242369 ATGGGACTCCAGGAGTCAGCTGG - Intronic
1176111686 20:63413793-63413815 CTTGGACTCCATGCCACAGCAGG + Intronic
1176124318 20:63468687-63468709 CTTTTGCGCCAGGCCTCAGCTGG - Intronic
1177567230 21:22840135-22840157 CTTGAACTCCTGGACTCAAGTGG + Intergenic
1178172927 21:30062057-30062079 CTTGAACTCCCGAACTCAGGTGG - Intergenic
1178488682 21:33034253-33034275 CAGGGCCTCCAGGACTCAGCAGG - Intergenic
1180943786 22:19678602-19678624 CTTGGACTCCTGGACTCAAGTGG + Intergenic
1182329341 22:29539563-29539585 CCTGTAGACCAGGACTAAGCAGG - Intronic
1182826135 22:33266441-33266463 CTTGAACTCCTGACCTCAGCTGG + Intronic
1183136868 22:35897450-35897472 CTTGTTGTCCAGGACTCAAATGG + Intronic
1183455046 22:37918023-37918045 CTCCTTCTCCAGGACTCAGGTGG + Intronic
1183869050 22:40727100-40727122 CTTGAACTCCGGGCCTCAGGTGG + Intergenic
1184282293 22:43444580-43444602 CTTGAACTCCTGAACTCAGGTGG + Intronic
1184813026 22:46850094-46850116 CATGCACTCCAGCACACAGCAGG - Intronic
1184913816 22:47553332-47553354 CTTGAACTCCTGGACTCAAGCGG + Intergenic
1184932777 22:47693496-47693518 CCTCTCCTCCAGGACTCAGTGGG + Intergenic
949979064 3:9488647-9488669 CTTGAACTCCTGGTCTCAGCCGG - Intergenic
950261275 3:11544635-11544657 CTTGGACTCCAGGGCCCAGAAGG - Intronic
952246726 3:31602037-31602059 CTTGAACTCCTGGACTCAAGTGG - Intronic
952479741 3:33748970-33748992 CTTGAACTCCAGGCCTCAAGTGG + Intergenic
952966803 3:38626023-38626045 CTTGTACTACAGGCCTTGGCTGG + Intronic
954318516 3:49814566-49814588 CTTGAACTCCAGACCTCAGGTGG - Intergenic
955309811 3:57874205-57874227 CTTGAACTCCTGGGCTCAGGGGG - Intronic
961861142 3:129917742-129917764 CTTGTCCACCAGGGCTCACCTGG - Intergenic
962294660 3:134171780-134171802 CTTGTACTCCTGGGCTCAAGTGG - Intronic
963060278 3:141220013-141220035 CTTGTGCTCCAGGTGGCAGCTGG - Intergenic
963204885 3:142623041-142623063 CTTGTACTCCTGGGCTCAGGTGG + Intronic
965982473 3:174710471-174710493 CTTGAACTCCAGACCTCAGGTGG + Intronic
966203415 3:177380274-177380296 CTTGAACTCCTGGGCTCAACTGG + Intergenic
966944621 3:184769140-184769162 CTTGTCCTCTAGGGCCCAGCAGG - Intergenic
968543626 4:1183019-1183041 CTTGAACTCCTGACCTCAGCTGG - Intronic
969271237 4:6104791-6104813 CCTTCACTCCAGGACTCAGGAGG + Intronic
971263638 4:25078726-25078748 CTAATACACCAGGGCTCAGCAGG - Intergenic
971323081 4:25621115-25621137 CGTGTGCTCCAGGAGACAGCTGG - Intergenic
971573998 4:28251036-28251058 ATTGAAATCCAGGAGTCAGCAGG - Intergenic
972596944 4:40537922-40537944 CTTGAACTCCTGGACTCAAGTGG + Intronic
972707119 4:41555962-41555984 CTTGAACTCCTGGGCTCAGGGGG + Intronic
972869948 4:43285530-43285552 ATTTTACTCAAGGACTCAACTGG - Intergenic
974335188 4:60534550-60534572 CTTGAACTCCTGGACTCAAGTGG - Intergenic
976582322 4:86751537-86751559 CTTGAACTCCTGGACTCAAGGGG + Intronic
977624682 4:99177305-99177327 CTTGAACTCCTGGGCTCAGGCGG + Intergenic
977685912 4:99847672-99847694 AATGAACTCCAGGACTCAGCTGG - Intronic
978987933 4:115038754-115038776 CTTGAACTCCTGGACTCAAGTGG - Intronic
980922122 4:139097246-139097268 CTTGAACTCCCGGGCTCAGGTGG + Intronic
980962214 4:139486527-139486549 CTTGAACTCCAGACCTCAGGTGG - Intergenic
981655807 4:147111538-147111560 CTTGAACTCCTGAACTCAGGTGG - Intergenic
987075092 5:14373851-14373873 CTTGAGCTGCAGAACTCAGCTGG - Intronic
988190039 5:27918598-27918620 CTTGAACTCCTGGACTCAAGTGG + Intergenic
988588379 5:32527532-32527554 CTTGACCTCCTGGACTCAGGTGG - Intergenic
988797157 5:34662006-34662028 CTTGAACTCCTGGGCTCAGAAGG + Intronic
990589123 5:57243906-57243928 CTTGGACTCCTGGACTCAAGCGG + Intronic
993395509 5:87382169-87382191 CTTGAACTCCTGGCCTCAGGTGG + Intronic
995635749 5:114188030-114188052 CTTGAACTCCCGGCCTCAGGTGG + Intergenic
995846543 5:116499900-116499922 CTTGTACTCGATGATTTAGCAGG - Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998423912 5:142011695-142011717 CTTCTGCTCCAGGATTCTGCAGG + Intronic
998894864 5:146788509-146788531 CTTGAACTCCTGGCCTCAGGTGG - Intronic
1002193980 5:177492425-177492447 CTTCTCCTCCAGGGCCCAGCCGG - Exonic
1003666575 6:8117143-8117165 CTTGGACTCCTGAACTCAGGTGG + Intergenic
1004328799 6:14702078-14702100 CTTGTTTTTCAGCACTCAGCAGG - Intergenic
1004462279 6:15848761-15848783 CTTGTCATCCAGGTCTCCGCTGG + Intergenic
1004468112 6:15904571-15904593 CCTGTACTCCATGGATCAGCTGG - Intergenic
1004470560 6:15925245-15925267 CTTGTACTCTAAAACTCAGTGGG + Intergenic
1004997041 6:21203595-21203617 CTTGAACTCCAGGCCTCAAACGG + Intronic
1006575017 6:35038703-35038725 CTTGAACTCCTGGACTCAAGAGG + Intronic
1007680897 6:43632722-43632744 CTTAAACTTCTGGACTCAGCCGG + Intronic
1010758007 6:79690074-79690096 CTTGAACTTCAGGGCTCAGTTGG + Intronic
1011138072 6:84121157-84121179 CTTGAACTCCTGGACTCAAGTGG + Intergenic
1011497763 6:87953118-87953140 CTTGGACTCCAGGATCCAGATGG + Intergenic
1013664252 6:112330393-112330415 CTTATACTCCAGGAAGCAGCAGG + Intergenic
1014005188 6:116409824-116409846 TCTGTCCTTCAGGACTCAGCAGG - Intronic
1015769669 6:136755485-136755507 CTTGAACTCCTGGGCTCAGGCGG - Intronic
1016008007 6:139108942-139108964 CTTGAACTCCTGGGCTCAGGAGG - Intergenic
1017432466 6:154384623-154384645 CTTGCCCTCAAGGAATCAGCAGG + Intronic
1017499352 6:155009319-155009341 CTTGAACTCCTGAACTCAGGTGG + Intronic
1018707531 6:166474015-166474037 CGTGTCCCACAGGACTCAGCCGG + Intronic
1018924664 6:168197868-168197890 CTGGGATTCCTGGACTCAGCAGG - Intergenic
1019991324 7:4693693-4693715 ACTTTACTCCAGGACTCACCTGG - Intronic
1020261189 7:6531534-6531556 CTGGGCCTCCAGGGCTCAGCAGG + Intronic
1021013027 7:15495210-15495232 CTTAAGCTCCAGGACTCAGAAGG + Intronic
1023052695 7:36267150-36267172 CTGTTACTGCAGTACTCAGCTGG + Intronic
1023409440 7:39874787-39874809 CTTGTACTCCTGGGCTCAAGGGG + Intergenic
1025043490 7:55669235-55669257 CTTGTACTCCTGGGCTCAAGGGG - Intergenic
1025605781 7:63039006-63039028 TTTGTACCCCAGGAGGCAGCAGG + Intergenic
1026733358 7:72930772-72930794 CTTGAACTCCTGGACTCAAGAGG - Intronic
1027362379 7:77422655-77422677 CTTGTACTCCATGGATCAGCTGG + Intergenic
1027387659 7:77674550-77674572 CTCAAACTCCAGGACTCAGGTGG - Intergenic
1027485828 7:78760775-78760797 CTTGTCCTCTTGAACTCAGCTGG + Intronic
1028149995 7:87361051-87361073 CTTGAACTCCTGGGCTCAGGTGG + Intronic
1029127498 7:98304766-98304788 CTTGAACTCCTGACCTCAGCTGG + Intronic
1029296477 7:99544109-99544131 CTTGAACTCCTGGCCTCAGGTGG - Intergenic
1033158742 7:138979058-138979080 CCTGTGCTCCAGGATCCAGCTGG - Intronic
1034571099 7:151957084-151957106 CTTGAACTCCTGGACTCACATGG - Intronic
1036526238 8:9537366-9537388 CTTGTACTCCAGCATGCAGATGG + Intergenic
1040797119 8:51298769-51298791 CCTGTACTTCAGGGCTGAGCCGG - Intergenic
1041119249 8:54569926-54569948 CTCGTCCTCCAGGTCTCAGGTGG - Intergenic
1041405709 8:57497013-57497035 CTTGTCCTTCCAGACTCAGCTGG + Intergenic
1042824995 8:72971309-72971331 CTTGAACTCCTGGACTCAAGTGG - Intergenic
1044423368 8:92024287-92024309 CTTGAACTCCAGTACTCAAGTGG - Intronic
1048432920 8:134387195-134387217 CCTGGACTCCAGGGCACAGCTGG - Intergenic
1048934380 8:139342974-139342996 CTTGTACCCCAGCAATTAGCTGG - Intergenic
1049053006 8:140213982-140214004 TTTATCCTCCAGGTCTCAGCTGG + Intronic
1049821102 8:144634142-144634164 CTAGAACTCCAGGCCTCTGCAGG + Intergenic
1049821109 8:144634183-144634205 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821116 8:144634224-144634246 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821123 8:144634265-144634287 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821130 8:144634306-144634328 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821137 8:144634347-144634369 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821144 8:144634388-144634410 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821151 8:144634429-144634451 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821158 8:144634470-144634492 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821165 8:144634511-144634533 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821172 8:144634552-144634574 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821179 8:144634593-144634615 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821186 8:144634634-144634656 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821193 8:144634675-144634697 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821200 8:144634716-144634738 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821207 8:144634757-144634779 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821214 8:144634798-144634820 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821221 8:144634839-144634861 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1051297357 9:15610776-15610798 CTTGAACTCCTGGACTCAAGTGG + Intronic
1053859677 9:42374188-42374210 CTTGAACTCCTGGACTCAAGTGG - Intergenic
1056164636 9:83929336-83929358 CTTGAACTCCTGGACTCAAATGG + Intergenic
1056877011 9:90343217-90343239 CTTGAACTCCTGGCCTCAGGTGG + Intergenic
1056953672 9:91065732-91065754 CATGAACTCCAGGAATCACCAGG + Intergenic
1057500861 9:95595880-95595902 CAGATGCTCCAGGACTCAGCAGG + Intergenic
1057774088 9:97991332-97991354 CTTGGACTCCTGGGCTCAGGTGG + Intronic
1058716180 9:107723847-107723869 CTTGAACTCCTGGACTTAGGCGG + Intergenic
1059668036 9:116467587-116467609 TTTGAACTCCTGGATTCAGCTGG + Intronic
1059983246 9:119796325-119796347 CTTATACTCCTGGACTCAAGCGG + Intergenic
1060657785 9:125384501-125384523 CTTGAACTCCTGGCCTCAGGTGG + Intergenic
1061147165 9:128806721-128806743 CTTGAACTCCAGACCTCAGGTGG - Intronic
1061393275 9:130329660-130329682 CTTGAACTCCTGGCCTCAGGTGG + Intronic
1061571497 9:131480513-131480535 CTTTTACTCCAGAATTCTGCAGG + Intronic
1061857473 9:133450076-133450098 CTTGCACTCCTGGACTCAAGTGG - Intronic
1062243904 9:135553524-135553546 CTTGTACGCTTGGACTCACCTGG - Intergenic
1062313191 9:135950871-135950893 CTTGAACTCCTGGGCTCAGGTGG - Intronic
1062713476 9:137989451-137989473 CATGTTCTCCAGGACTCACTCGG - Intronic
1187137186 X:16559348-16559370 CATCTCCTCCAGGACACAGCTGG + Intergenic
1188244450 X:27823329-27823351 CTTGTCCTCTAGGACTTAGTGGG - Intergenic
1188896000 X:35668967-35668989 CTTGAACTCCAGGGCTCAAATGG + Intergenic
1189394613 X:40609893-40609915 CTTGAACTCCTGGACTCAAGTGG - Intergenic
1189508544 X:41637861-41637883 CTTGAACTCCTGGACTCACACGG + Intronic
1191585465 X:62821658-62821680 TTTTTACTCCAGGCCTCAACGGG + Intergenic
1192362639 X:70449247-70449269 CTAGTTCTCCAGGCCTCAGAAGG - Intronic
1192805922 X:74509181-74509203 CTTGAACTCCTGGACTCAAGTGG + Intronic
1193741771 X:85225836-85225858 CTTGTGCTCCAGGAATTAGGAGG + Intergenic
1194684312 X:96893797-96893819 CTTGCACTCCAGGTGCCAGCTGG - Intronic
1195370739 X:104169785-104169807 CTTGAACTCCAGACCTCAGGTGG + Intronic
1196069048 X:111499204-111499226 CTTGAACTCCTAGACTCAACGGG + Intergenic
1197337702 X:125228223-125228245 CTTGAACTCCTGAACTCAGGTGG - Intergenic
1197613268 X:128662732-128662754 CCTGTCCTCCAGGATGCAGCAGG - Intergenic