ID: 1050333869

View in Genome Browser
Species Human (GRCh38)
Location 9:4571997-4572019
Sequence ATTTTAACTTCGGGGAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050333869 Original CRISPR ATTTTAACTTCGGGGAGCAA GGG Intronic
907226215 1:52949445-52949467 ATTTTAACTTCCTGCAGAAAGGG + Intronic
909090946 1:71224863-71224885 ATTTAAACTTCAGGGAGCAGTGG - Intergenic
915057202 1:153144109-153144131 CTTTTAACTTCAGGGGACAAAGG + Intergenic
918921677 1:190720055-190720077 TTTTTAATGTTGGGGAGCAAAGG + Intergenic
1065135667 10:22666780-22666802 AATGTACGTTCGGGGAGCAAAGG - Intronic
1068884099 10:62080637-62080659 ATTTTAATTTCTGGCTGCAAAGG + Intronic
1073773130 10:106757190-106757212 ATTTTTATTTCTGGTAGCAATGG - Intronic
1078047388 11:7928308-7928330 ATGTTTTCTTCTGGGAGCAATGG - Exonic
1079030006 11:16979569-16979591 ATTTTAGTTTCAGGGAGCTATGG - Intronic
1080351903 11:31394575-31394597 TTTTTAACTTCAGAGTGCAATGG - Intronic
1081114445 11:39182096-39182118 ATTTTAACTTCCAGAAGCCAGGG + Intergenic
1081902829 11:46643877-46643899 AATTTAACTTTGGGGAGTTATGG - Intronic
1085018230 11:73189226-73189248 ATTTTAGCTTCTGAGAACAAAGG + Intergenic
1086771907 11:90776690-90776712 ATTTTAATGGGGGGGAGCAATGG - Intergenic
1091125686 11:133093456-133093478 ATTATAGTTACGGGGAGCAAGGG - Intronic
1097739786 12:63227443-63227465 TTTTTACCTTCGGAAAGCAAAGG - Intergenic
1100093542 12:91002747-91002769 ATTTGAACATCTGGCAGCAATGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1106594971 13:31127988-31128010 TTTTTAACTTCTGTGAGGAATGG + Intergenic
1107846491 13:44519394-44519416 ATTTTAGCTACAGGGAGAAATGG + Intronic
1108614819 13:52121983-52122005 ATTTTAACTCCTGGGGTCAAGGG + Intronic
1109923562 13:69103765-69103787 CTTTTCATTTCTGGGAGCAAGGG + Intergenic
1111644220 13:91010062-91010084 ATTTTAACTTATGGTAGAAATGG + Intergenic
1111848725 13:93544535-93544557 ATTTTAATTTCATGAAGCAAAGG + Intronic
1114492700 14:23113359-23113381 ATTCTGACTTCAGAGAGCAATGG - Intergenic
1117121952 14:52577673-52577695 ATTTAAACTTAGGGGTGCAGTGG + Intronic
1121025194 14:90610487-90610509 ATTTTAAGTTCCAAGAGCAAAGG + Intronic
1121111686 14:91317225-91317247 GTTTTAACTTCAGGGAACTATGG + Intronic
1122926998 14:104908642-104908664 ATGTTACCTTAGGGGAGGAATGG - Intergenic
1124950610 15:34316301-34316323 TTTTTAACTTAGGAGAACAAGGG + Intronic
1125061080 15:35425142-35425164 ATTAAAACTTCTTGGAGCAAGGG - Intronic
1125623951 15:41090806-41090828 ATTTTAACTTTAGGTAGCAGTGG - Intronic
1128321914 15:66700764-66700786 ATCTTTCTTTCGGGGAGCAACGG + Intergenic
1130051352 15:80486545-80486567 AGTTTAACTGCGGGGAGGACAGG + Intronic
1138848777 16:60600563-60600585 ATTTTAAGTTCGGGGTACATGGG + Intergenic
1139117182 16:63969802-63969824 TTTTTTACTTTGGGGTGCAATGG + Intergenic
1139231027 16:65282453-65282475 ATTTTAACTTGAGGGAATAATGG + Intergenic
1151522496 17:74640377-74640399 TTCTTAACTTCGGGGAGCTGAGG + Intergenic
1154247544 18:12712976-12712998 ATTTTCAGTTCGGGTAGCATTGG + Intronic
1165185029 19:34011696-34011718 GTTTTACCTGCGGGGTGCAAGGG - Intergenic
933375508 2:81475350-81475372 ATTAAAACTTCAGGGAGAAACGG - Intergenic
936601128 2:113895711-113895733 ATTTTATTTACGGGTAGCAAAGG + Intronic
939362662 2:141193703-141193725 ATTTTAGGTTCGGGGTACAAGGG - Intronic
941985616 2:171508505-171508527 CTATTAACTTCGGTGTGCAAAGG - Intergenic
1170299421 20:14866413-14866435 ATTTTAATTTCAGTGAGCAATGG - Intronic
1170735387 20:19009697-19009719 CTTTCAACTTGGGGGAGGAAGGG - Intergenic
1174051053 20:47767949-47767971 ATTTGAACTTTGTGGACCAAGGG - Intronic
1174807939 20:53620830-53620852 ATTTTATTTTTGGAGAGCAATGG + Intergenic
1177127513 21:17214301-17214323 ATTTTAACTTAGTGGAGCTTTGG - Intergenic
1181235229 22:21444511-21444533 CTTTAAACTTCGGGAAGCAGAGG - Intronic
1184833134 22:47003308-47003330 TCTGTAACCTCGGGGAGCAAAGG - Intronic
1185153766 22:49181245-49181267 ATGATAATTTCCGGGAGCAAGGG + Intergenic
951003064 3:17586749-17586771 ATTTTAACTCCTGGAAGAAAGGG + Intronic
952689217 3:36184214-36184236 ATTTTAACTTCTTGGATTAAAGG + Intergenic
953500662 3:43430647-43430669 ATTTTAAATTAGGGAAGAAATGG - Intronic
954568844 3:51623673-51623695 ATTTAGAATTAGGGGAGCAAAGG + Intronic
958521455 3:95193238-95193260 ATTTTAATTTGGGGCACCAAAGG - Intergenic
959387504 3:105729271-105729293 ACTTTAACTTCTTGGAGCTAAGG + Intronic
959716557 3:109439949-109439971 ATTTTAACACCAGAGAGCAATGG - Intergenic
959982240 3:112529094-112529116 TTTTTAACATCCGGGGGCAAAGG + Intergenic
960551027 3:118976671-118976693 CTTATAACTTCGGGGAAGAAGGG - Intronic
963900234 3:150726558-150726580 ATTTTCACTTCCTGGAGCACAGG - Intergenic
965227848 3:166012751-166012773 ATTTTAAGTTCAGGGATAAATGG - Intergenic
967136816 3:186519550-186519572 AGCTTAGCTTGGGGGAGCAAAGG + Intergenic
968712018 4:2126284-2126306 ATTTTATATACGGGGAGCAGAGG - Intronic
973178210 4:47234513-47234535 ATTTTAACTTGGGGAAGCTGAGG - Intronic
974455014 4:62118588-62118610 ATTTTAACTTCAGGGACTGAAGG + Intergenic
977329532 4:95620130-95620152 ATATTAAATTCGGGCAGTAATGG - Intergenic
982590737 4:157306194-157306216 GTTTTAACTAGAGGGAGCAATGG - Intronic
982731490 4:158960085-158960107 ATTTTAATTAAGGGGAGAAAAGG - Intronic
983945239 4:173578623-173578645 GTTTTTACTTTGGGGTGCAAGGG + Intergenic
992686953 5:79208495-79208517 ATTTGAACTTCTGGGCTCAAGGG - Intronic
992938389 5:81736477-81736499 CTTTTAAATTCGAGGAGAAAAGG - Intronic
1000385219 5:160668936-160668958 TTTTTAAGTTCTAGGAGCAAGGG - Intronic
1000807777 5:165818308-165818330 ATATTAACTTCTGGGATAAATGG - Intergenic
1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG + Intergenic
1004886451 6:20055832-20055854 ATTTTAATTTTGGGAAGCCATGG - Intergenic
1006090164 6:31623951-31623973 ACTTGAACTTCAGGGAGCATTGG + Intronic
1006412260 6:33881034-33881056 ATTTTTACTTCCTGGAGGAAGGG - Intergenic
1010558221 6:77312732-77312754 ATTTAAACTTCAGTAAGCAAAGG - Intergenic
1014515541 6:122374154-122374176 ATCTTGACTTCTAGGAGCAATGG - Intergenic
1015961131 6:138650326-138650348 ATTTGAACACCGGGGAGTAACGG + Intronic
1018426590 6:163688366-163688388 ATTTTAACTTGGGAGAATAAAGG - Intergenic
1021002938 7:15356074-15356096 ATTACAACTTCGGTGAGGAAAGG + Intronic
1028808368 7:95055236-95055258 ATTTTAACTGGGGAGAGGAATGG - Intronic
1031387029 7:121163821-121163843 ATTTTATCTTTGGAGAGCTATGG - Intronic
1040093565 8:43420685-43420707 ATTTTGACTTCTGGAGGCAAGGG + Intergenic
1040988237 8:53319592-53319614 ATTTTAACTTGGGGCAAGAAGGG - Intergenic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1046261883 8:111779534-111779556 TTTTTAACTTGAGGCAGCAAAGG + Intergenic
1050333869 9:4571997-4572019 ATTTTAACTTCGGGGAGCAAGGG + Intronic
1051286477 9:15502490-15502512 ATTTGAACTCCTGGGATCAAGGG + Intronic
1052232025 9:26165170-26165192 ATTATGATTTGGGGGAGCAAAGG + Intergenic
1055283194 9:74698323-74698345 ATCCTAACTTCAGGGAGGAATGG - Intergenic
1056403377 9:86249854-86249876 AGCTTAACTTCAGAGAGCAAAGG - Intronic
1057914573 9:99045972-99045994 TTCTTAACTTCAGGGACCAAAGG - Intronic
1062616381 9:137398382-137398404 AGGTGAACTTCGGGGAGCACAGG - Intronic
1186780368 X:12905969-12905991 ATTTTATGCTCGGAGAGCAAGGG - Intergenic
1187096937 X:16158518-16158540 ATTTTAAATTGGGGGAAAAAAGG - Intergenic
1188458994 X:30400998-30401020 ATTTAGACTTCTGGCAGCAATGG + Intergenic
1188649836 X:32618646-32618668 ATTTTAACTTTTAGGTGCAAGGG - Intronic
1189895589 X:45652619-45652641 ATTTTAAGTTCAGGGTACAAGGG + Intergenic
1195526674 X:105899022-105899044 AATTTAACTTCCAGGAGCAAAGG + Intronic
1196895568 X:120332450-120332472 ATTTTAACTGGGGGGATCCATGG - Intergenic