ID: 1050334046

View in Genome Browser
Species Human (GRCh38)
Location 9:4573820-4573842
Sequence GGGAAGGAACACTCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050334046_1050334054 11 Left 1050334046 9:4573820-4573842 CCCACACTGGAGTGTTCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050334046 Original CRISPR GGGAAGGAACACTCCAGTGT GGG (reversed) Intronic