ID: 1050334054

View in Genome Browser
Species Human (GRCh38)
Location 9:4573854-4573876
Sequence CATGAGAAAGCACTTGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050334049_1050334054 -9 Left 1050334049 9:4573840-4573862 CCCCACCAACCTAGCATGAGAAA 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223
1050334044_1050334054 25 Left 1050334044 9:4573806-4573828 CCAAGCTGAGGGTGCCCACACTG 0: 1
1: 0
2: 0
3: 21
4: 241
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223
1050334050_1050334054 -10 Left 1050334050 9:4573841-4573863 CCCACCAACCTAGCATGAGAAAG 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223
1050334046_1050334054 11 Left 1050334046 9:4573820-4573842 CCCACACTGGAGTGTTCCTTCCC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223
1050334047_1050334054 10 Left 1050334047 9:4573821-4573843 CCACACTGGAGTGTTCCTTCCCC 0: 1
1: 0
2: 0
3: 17
4: 201
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223
1050334048_1050334054 -5 Left 1050334048 9:4573836-4573858 CCTTCCCCACCAACCTAGCATGA 0: 1
1: 0
2: 1
3: 28
4: 233
Right 1050334054 9:4573854-4573876 CATGAGAAAGCACTTGATGACGG 0: 1
1: 0
2: 1
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050334054 Original CRISPR CATGAGAAAGCACTTGATGA CGG Intronic