ID: 1050335107

View in Genome Browser
Species Human (GRCh38)
Location 9:4583066-4583088
Sequence GCTGCTGGCGTGCCCCAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050335100_1050335107 26 Left 1050335100 9:4583017-4583039 CCTGCTGGTATGTTTCTGCAGTA 0: 1
1: 0
2: 0
3: 3
4: 160
Right 1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG 0: 1
1: 0
2: 5
3: 37
4: 339
1050335103_1050335107 -3 Left 1050335103 9:4583046-4583068 CCACATCTGCCAGCATCGGAGCT 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG 0: 1
1: 0
2: 5
3: 37
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050335107 Original CRISPR GCTGCTGGCGTGCCCCAGGC TGG Exonic
900005983 1:51752-51774 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
900297243 1:1957911-1957933 GCTGCTCGGGTGCCCTAGGACGG + Intronic
900310363 1:2030469-2030491 CCTGCCGGAGAGCCCCAGGCTGG - Exonic
900417108 1:2540335-2540357 GCAGCTGGCGTGCCCTGCGCAGG - Intergenic
900586424 1:3434589-3434611 GCTGCAGGCCTGCCCGAGGCTGG + Exonic
900639565 1:3682219-3682241 GCTCCAGGGATGCCCCAGGCAGG + Intronic
900663217 1:3796383-3796405 GCTGCTGACGGGGCCCGGGCTGG - Exonic
900950809 1:5857360-5857382 GCTGGTGGCGTGCCCACGGGAGG - Intergenic
900981464 1:6048464-6048486 GCTCATGGTGTGGCCCAGGCAGG - Intronic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
901870260 1:12134727-12134749 GCTTCGGGCGTGTCCCAGGCAGG + Intronic
902444408 1:16452805-16452827 GCTCCTGGCCTTCCCCAGGCTGG + Intronic
902571067 1:17347449-17347471 GCTGCTCCAGTGGCCCAGGCTGG + Intronic
903166413 1:21523641-21523663 CATGCTGGGCTGCCCCAGGCAGG - Intronic
905105452 1:35561008-35561030 GCCGCAGGCGTGTGCCAGGCGGG - Exonic
907242745 1:53089884-53089906 GCAGCTGGCATCCCCCAGGCCGG - Exonic
907392726 1:54168727-54168749 GCTGCTGGGGTTGCCCAGGTAGG - Intronic
907394027 1:54177245-54177267 GCTGCAGCTGTGGCCCAGGCAGG + Intronic
913519460 1:119631607-119631629 GGGGCTGGCGGGGCCCAGGCGGG - Intronic
916120864 1:161526541-161526563 GGTGCTGGGGTCCCCCTGGCGGG - Exonic
917325390 1:173826110-173826132 GCTGCTGGGGAGGCCGAGGCAGG + Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
922620016 1:226983478-226983500 GTTGGGGGAGTGCCCCAGGCAGG + Intronic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
1062898248 10:1121550-1121572 GCTGCTCTCGTTACCCAGGCTGG + Intronic
1064444137 10:15378775-15378797 GCTGCTCCTGTGCCCCAGTCAGG + Intergenic
1064666464 10:17657065-17657087 TCTGGTGGAGTGCCCCAGGAAGG + Intronic
1067258514 10:44666191-44666213 GCTCCTGGCTTGCCCTTGGCAGG - Intergenic
1069557160 10:69406085-69406107 CCTTTTGGCCTGCCCCAGGCGGG + Intronic
1070154419 10:73824779-73824801 GCTCCTGGAGTGCCTCATGCTGG - Intronic
1070535668 10:77375480-77375502 GCTGCTTGGTAGCCCCAGGCAGG - Intronic
1071857989 10:89645109-89645131 GGGGCTGGCGTGCTCCAGGCCGG - Exonic
1073057221 10:100710384-100710406 GCGGCTAGGGCGCCCCAGGCCGG - Intergenic
1073875547 10:107917794-107917816 GCTGCTCTGGTGCTCCAGGCAGG - Intergenic
1075099465 10:119496017-119496039 GCTACTGGGGAGCCTCAGGCAGG - Intergenic
1075959527 10:126556574-126556596 TCTGCTGGAGTTCCACAGGCTGG - Intronic
1076575105 10:131460662-131460684 GCTTCTGGCTTCCCCCAGGAGGG + Intergenic
1076829023 10:132985097-132985119 GCTGGTGGGTTGCCCCAGGCGGG + Intergenic
1077360114 11:2137122-2137144 CCTGCTGCCCTGCCTCAGGCTGG + Intronic
1077578132 11:3399674-3399696 CCTTCTGAAGTGCCCCAGGCTGG + Intergenic
1078699715 11:13668889-13668911 GCTGCAGGCCTGGCCGAGGCGGG + Intronic
1080457469 11:32429728-32429750 GCTGCTGGGGTGGCCCTGCCAGG - Intronic
1081447324 11:43143336-43143358 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1081579780 11:44344361-44344383 ACTGCTGGGGTGCCCAGGGCTGG + Intergenic
1083540926 11:63511084-63511106 CCTGCTGATGAGCCCCAGGCTGG + Exonic
1084232876 11:67765847-67765869 CCTTCTGCAGTGCCCCAGGCTGG + Intergenic
1085251479 11:75146895-75146917 GCTACTGGGGTGCCTGAGGCAGG + Intronic
1085295600 11:75430005-75430027 GCTGCTGGCGGACCCCGCGCTGG - Exonic
1088109888 11:106249165-106249187 ACTACTTGCGTGACCCAGGCAGG - Intergenic
1089324691 11:117649187-117649209 GCTGCTGGGGTGGCTGAGGCAGG - Intronic
1090345084 11:126062939-126062961 GCTGCTCGCGTGCTCCGGGCCGG - Intronic
1090645100 11:128760886-128760908 GCTGCTGGCTTGCACCAGGCAGG - Intronic
1090972045 11:131652582-131652604 GCTGCTGTCTTGCCCCAAGTTGG - Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091282736 11:134391283-134391305 CCAGCTGGCGTTCTCCAGGCTGG - Exonic
1091458684 12:627830-627852 GCTACTTGCGTGCCTGAGGCAGG + Intronic
1091816604 12:3443572-3443594 GCTGTTGTAGTGCTCCAGGCAGG - Intronic
1092062874 12:5565208-5565230 GCTGTTTGTCTGCCCCAGGCTGG + Intronic
1094476330 12:30843478-30843500 GCTGCTGTAGTACTCCAGGCAGG + Intergenic
1094637537 12:32240984-32241006 TCTGCTGACTGGCCCCAGGCAGG - Intronic
1096103498 12:48983246-48983268 GCTGCCTGTGTGGCCCAGGCTGG - Intergenic
1096269860 12:50156290-50156312 GCTGCTGGGGAGGCCAAGGCAGG + Intronic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1096651762 12:53065342-53065364 GCTGCTGTCATACCCCTGGCAGG - Exonic
1096863862 12:54549748-54549770 GCGGCTGGCGTGGACCAGCCAGG - Exonic
1100445958 12:94660141-94660163 GCTGCTTGCGAGGCCTAGGCAGG + Intergenic
1101329602 12:103746799-103746821 GCTGCTGAAGTGGCCCAGACAGG - Intronic
1101735098 12:107457485-107457507 GGTGCTGGCGGGTCCCAGGCAGG + Intronic
1102069175 12:110003316-110003338 TCACCTGGCCTGCCCCAGGCTGG - Intronic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1102848834 12:116218843-116218865 GCTGCTGGGGTGGCTCAGGCTGG - Intronic
1103903516 12:124315657-124315679 CCTGCTGGGCTGCCCCAGGCTGG - Exonic
1103950422 12:124548071-124548093 GGGCCTGGGGTGCCCCAGGCCGG + Intronic
1104880216 12:132065516-132065538 GCTCATGGACTGCCCCAGGCAGG + Intronic
1104952542 12:132448194-132448216 GCTGCTGGTGTGGACCTGGCTGG + Intergenic
1105067737 12:133215460-133215482 GCCTCTGGGGAGCCCCAGGCTGG - Intergenic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106480474 13:30133599-30133621 GCGGCTGGGGCGTCCCAGGCAGG - Intergenic
1108708078 13:53008038-53008060 GCTGATGTTTTGCCCCAGGCAGG + Intergenic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110318183 13:74134261-74134283 GCTGCCGGCGAGCCCCGGGGTGG + Intergenic
1113764798 13:112874581-112874603 GTTGCTGGCTTTCCCTAGGCCGG - Intronic
1113922194 13:113919434-113919456 GCAGGTGTCGGGCCCCAGGCTGG + Intergenic
1113937086 13:114000190-114000212 TCTGCTGGGGTGCCCTGGGCCGG + Intronic
1113975688 13:114225711-114225733 ATTGCAGGCGTGGCCCAGGCTGG + Intergenic
1115507030 14:34102534-34102556 GGTTCTGCCATGCCCCAGGCTGG - Intronic
1116276370 14:42838906-42838928 TCTGGTGGCGTGCCCCAGGAAGG - Intergenic
1116276451 14:42839562-42839584 TCTGGTGGCGTGCCCCAGGAAGG - Intergenic
1116608610 14:47036156-47036178 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1117092851 14:52267931-52267953 GCTGCTGGCGCGCTCGGGGCTGG + Exonic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1117720879 14:58627690-58627712 GCTACTGGGGAGCCCAAGGCAGG + Intergenic
1119262464 14:73245786-73245808 GCTGCTGGGTTGGCCCAGCCTGG + Intronic
1119615741 14:76097854-76097876 GCTGCTGGCATGATCCAGGGAGG + Intergenic
1119744324 14:77033465-77033487 GCTGCCCGCGCGCCCCAGGCTGG - Intergenic
1122135311 14:99629241-99629263 GCTGCTGGACAGCCACAGGCTGG + Intergenic
1122420790 14:101575805-101575827 GCTGCTGCAGTTCCCCAAGCAGG - Intergenic
1122694674 14:103546883-103546905 GCACCTGGCGTGGCCCAGGCAGG + Intergenic
1122939092 14:104973292-104973314 GCTGCTGGCGGGGGCCAGGGAGG + Intronic
1123007912 14:105333304-105333326 TCCCCTGGCCTGCCCCAGGCGGG + Intronic
1123627786 15:22239381-22239403 GCTGCTGGGGAGTGCCAGGCAGG + Intergenic
1124156044 15:27226049-27226071 GGTGCTGGGATGTCCCAGGCAGG + Intronic
1124250952 15:28106429-28106451 GCTCCTGGCTTGGCCCAGTCTGG - Intergenic
1124635810 15:31364665-31364687 GCTGCTTCCTTGCCCCAGGCAGG + Intronic
1127287961 15:57547128-57547150 GCTGGTGGGGTGGGCCAGGCTGG - Intronic
1127991192 15:64119228-64119250 GCGGCTGGGGTGGCTCAGGCGGG - Intronic
1128245994 15:66133215-66133237 GCTGATGGGGTGGTCCAGGCAGG - Intronic
1128459917 15:67859341-67859363 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1128770222 15:70276550-70276572 GCCCCTGGGGTGCCCCAGCCAGG + Intergenic
1129331656 15:74830981-74831003 GCTGCTGCCCTGCCCAAGGAGGG - Exonic
1130275263 15:82472915-82472937 GGTGCTCTCGTGCCCCAGCCGGG + Intergenic
1130650449 15:85759541-85759563 GCAGCTGGCCTGACACAGGCGGG + Exonic
1131080042 15:89527091-89527113 GCTGCTGTCCTGCCCAGGGCAGG - Intergenic
1132447532 15:101939171-101939193 GCTGCTGGGGAGGCCGAGGCGGG - Intergenic
1132502728 16:291752-291774 GCTGCTGTGCTGCCCCAGGATGG - Intronic
1132618840 16:854988-855010 GCTCCTGGCCTTCCCCGGGCCGG - Intronic
1132721020 16:1315602-1315624 GCTGCTTGCCTGCCGCAGGCCGG - Intronic
1132809733 16:1791799-1791821 GGTGCTGGCGGGCAACAGGCTGG - Exonic
1132898122 16:2238426-2238448 GCAGGTGGCATGCCCCAGCCAGG - Exonic
1133109872 16:3541626-3541648 GCTGCAGGAGTGGTCCAGGCAGG - Intronic
1133139174 16:3731735-3731757 GCTGCAGCCGTGCCTCTGGCCGG - Intronic
1133139594 16:3734467-3734489 ACTGCTGCCATGCCACAGGCAGG + Intronic
1133294787 16:4746399-4746421 GCTGCGGGCCTGGCCCAGCCTGG - Exonic
1133298137 16:4765639-4765661 GCTGCTCGCGTACCCGAGCCTGG + Exonic
1134061611 16:11202759-11202781 CCTCCTGGCGATCCCCAGGCTGG + Intergenic
1134797729 16:17057022-17057044 GCTCCAGGCTTGCCCCAGCCTGG - Intergenic
1136293686 16:29290265-29290287 GCTCCTGCCCTGCCCTAGGCTGG + Intergenic
1136687334 16:32003044-32003066 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136787944 16:32946595-32946617 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136881837 16:33907194-33907216 GCAGCTGCCCCGCCCCAGGCAGG - Intergenic
1136922884 16:34346241-34346263 GCAGCTGGTGGGTCCCAGGCTGG + Intergenic
1136981689 16:35065565-35065587 GCAGCTGGTGGGTCCCAGGCTGG - Intergenic
1137531968 16:49283434-49283456 GCTGCTGGCGATCCCAAAGCTGG - Intergenic
1138537645 16:57668319-57668341 GCTCCTGGCGTGGGCAAGGCTGG + Exonic
1139594912 16:67951819-67951841 GCTGCTGGTGTGCTCCAGGGTGG - Exonic
1140411564 16:74744051-74744073 AGTCCTGGCGTGCCCCAGGTGGG - Intronic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141976172 16:87517971-87517993 GCTGCTGGGGAGTGCCAGGCAGG - Intergenic
1142034946 16:87856948-87856970 GCTGGGGGCGCTCCCCAGGCCGG - Intronic
1142099569 16:88264271-88264293 GCTCCTGCCCTGCCCTAGGCTGG + Intergenic
1203090174 16_KI270728v1_random:1208252-1208274 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1142525617 17:538226-538248 GCTCCTAGCCTGCCCCGGGCTGG + Intronic
1142671252 17:1488313-1488335 GCCGCTCGCGGGCCCCAGGGCGG + Intronic
1142866461 17:2794468-2794490 GCTGCTGGCTTCCCACAGGATGG - Intronic
1143472512 17:7184839-7184861 GCTGATGGAGGGCCTCAGGCTGG - Intergenic
1143491884 17:7289697-7289719 GCTGCTGGCGTGGCCTGGGGCGG + Exonic
1143758806 17:9086254-9086276 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
1145963740 17:28902618-28902640 GGTGCTGGCCTGCCGCAGCCAGG - Exonic
1147419748 17:40316668-40316690 GCTGTTGGCGGGGCTCAGGCTGG + Intronic
1147660072 17:42112616-42112638 GGTGCAGGCGAGACCCAGGCTGG - Exonic
1148177795 17:45582855-45582877 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1150311170 17:64130271-64130293 GCCGAGGGCGTGCCCCGGGCGGG + Intronic
1150321550 17:64218528-64218550 GCTACTGGGGAGCCCGAGGCAGG - Intronic
1150782450 17:68134381-68134403 CCTGCTGGCGCCACCCAGGCCGG - Intergenic
1151345582 17:73499408-73499430 GCATCTGGCCGGCCCCAGGCTGG - Intronic
1151572954 17:74936264-74936286 GCTTCCTGCGTGCCCCAGACCGG - Intronic
1151711523 17:75809724-75809746 GCTCCCGGCCTGCCCCACGCGGG + Intronic
1151852164 17:76697493-76697515 GCAGCTGGCGTCACCCTGGCTGG + Intronic
1151977373 17:77490310-77490332 GCTGCTCCCCTGCACCAGGCGGG - Intronic
1152005343 17:77676924-77676946 GCTGCTGGAATGCCCCACGCAGG + Intergenic
1152067491 17:78119534-78119556 CCTGGTGGGGTCCCCCAGGCTGG - Intronic
1152635360 17:81428591-81428613 GCTGCTGGGGTCCCCCAGGGTGG - Intronic
1154192474 18:12242424-12242446 GCTACTTGGGAGCCCCAGGCAGG - Intergenic
1155229283 18:23757366-23757388 GCTGCTGGAGAGCGCCAAGCAGG - Intronic
1155564695 18:27121112-27121134 GCTGCTGGAGAGCCTGAGGCGGG - Intronic
1157375271 18:47158368-47158390 CCTGCTGGAGTTGCCCAGGCTGG + Intronic
1157862591 18:51154215-51154237 GCTGCTAGACAGCCCCAGGCAGG - Intergenic
1158548752 18:58417348-58417370 GGAGCTGGCATTCCCCAGGCTGG - Intergenic
1158682292 18:59579672-59579694 TCTGTTGGCATGCTCCAGGCAGG - Intronic
1160637740 19:93358-93380 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1160826471 19:1082640-1082662 GCTGCGGGCGTGGCCCGGGTAGG + Intronic
1161001952 19:1915037-1915059 GCTGCTGGAGGCTCCCAGGCAGG - Intronic
1161080556 19:2308033-2308055 TCTGCGGGCGCGCCCCACGCCGG + Intronic
1161412446 19:4123965-4123987 GCTGCGGCCGCGGCCCAGGCCGG + Exonic
1161513228 19:4683148-4683170 GCGGCGGGGGGGCCCCAGGCCGG - Intronic
1161818171 19:6513024-6513046 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1163082318 19:14953012-14953034 GCTGCTGGCATCCCCCAGGCGGG - Exonic
1163285036 19:16341334-16341356 GCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1163287124 19:16355812-16355834 GCAGCTGGCGTGGGCCAAGCGGG - Exonic
1163392303 19:17038156-17038178 GCTGCTGGCGGAGCCGAGGCGGG - Intergenic
1163551407 19:17967923-17967945 GCTGCTGGCAGGCTCCTGGCGGG + Intronic
1163667567 19:18610466-18610488 GTTGCAGGCCTGCCCCAGGGAGG + Intronic
1163726157 19:18924315-18924337 GAGGCTGGCGGGCCCCAGGGTGG - Intronic
1165339050 19:35197527-35197549 GGTGCTGTCTTTCCCCAGGCAGG + Intergenic
1165759373 19:38311669-38311691 GCTGCTGGGGTGATCCAGGTGGG + Intronic
1165847573 19:38828341-38828363 GCTGCTGGAGAGCCTGAGGCAGG - Intronic
1166001115 19:39877955-39877977 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166003900 19:39894214-39894236 GCAGCTGGCGAGCCCCAGGCTGG - Exonic
1166762653 19:45234596-45234618 GACGCTGGCGGGCCCCGGGCCGG - Intronic
1166813874 19:45529927-45529949 GCTCCTTGCGTTGCCCAGGCTGG + Intronic
1166941842 19:46371801-46371823 GCTGCCTGCATGCCTCAGGCAGG + Intronic
1167148222 19:47694964-47694986 GCTGGTGAGGGGCCCCAGGCTGG - Exonic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168284110 19:55321938-55321960 CCTGCTGGAGTTCCCCAGGCAGG + Intronic
925386945 2:3468507-3468529 GCTCCTGGCATGTCCCAGGCAGG - Intronic
925448543 2:3949294-3949316 GCTCCTCGCGGTCCCCAGGCAGG - Intergenic
925735947 2:6963951-6963973 GCTGCTGGAGTGGGCCAGGAGGG - Intronic
929044308 2:37775464-37775486 GCTGCTGGTGGGGCCCAGGTGGG - Intergenic
933960326 2:87404285-87404307 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
934068760 2:88364519-88364541 GCTGATGGCTGGCCCCAGGCAGG - Intergenic
934244439 2:90295258-90295280 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
934264410 2:91502174-91502196 GCTACTGGGGAGGCCCAGGCAGG - Intergenic
934938606 2:98483412-98483434 GCTGCAGGGCTGCCCCAGGCGGG + Intronic
935017974 2:99202185-99202207 CCTGCTGGAGTGCCTCATGCAGG + Intronic
936062790 2:109306564-109306586 GCTGGTGGTGTTCTCCAGGCAGG + Intronic
939250913 2:139680678-139680700 ACTGGTGGTGTGCCCCAGGGAGG + Intergenic
941998808 2:171626606-171626628 GATGCTGTCGTGACCCAGCCAGG + Intergenic
942315510 2:174693333-174693355 GCACCTGGCTTGCCCCTGGCAGG + Intergenic
945929144 2:215837696-215837718 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
947445522 2:230159936-230159958 GCTGCCGGCCATCCCCAGGCGGG + Intergenic
948159466 2:235812310-235812332 GCGGCGGGCTTGCCCCGGGCAGG - Intronic
948279711 2:236737795-236737817 GCTGCTGGGCACCCCCAGGCTGG + Intergenic
948393090 2:237626671-237626693 GCTCCTGCCGTGCCCTAGGCAGG + Intergenic
948631389 2:239305011-239305033 CCTCCTGACATGCCCCAGGCCGG - Intronic
1168794214 20:600480-600502 CCTGCTGGGGAACCCCAGGCAGG + Intergenic
1169430404 20:5531289-5531311 GCTGCTTGCTTTCCCCAGCCAGG + Intergenic
1170424296 20:16223337-16223359 GCTGCTGGGGAGGCTCAGGCAGG - Intergenic
1170584218 20:17722146-17722168 GTTGCTGGAGAGCCCCAGGAGGG + Intronic
1171399097 20:24860122-24860144 GCTGTTGCTGTGGCCCAGGCAGG - Intergenic
1172182741 20:33013646-33013668 GCTGTGGGCCTGCCCCAGGTAGG + Intronic
1173307589 20:41864676-41864698 GCTGATGGCCTGCTCCAGGGAGG - Intergenic
1174578595 20:51555111-51555133 GCTGCTGCAGTGGTCCAGGCAGG - Intronic
1174598962 20:51708621-51708643 GCTGCTTGAGTGGCCGAGGCAGG + Intronic
1176132157 20:63500717-63500739 GGTGCTCGAGTGGCCCAGGCCGG + Intergenic
1176337247 21:5610582-5610604 TCTGTGGGCATGCCCCAGGCAGG - Intergenic
1176470909 21:7105808-7105830 TCTGTGGGCATGCCCCAGGCAGG - Intergenic
1176494470 21:7487586-7487608 TCTGTGGGCATGCCCCAGGCAGG - Intergenic
1176506172 21:7650797-7650819 TCTGTGGGCATGCCCCAGGCAGG + Intergenic
1178244123 21:30935654-30935676 GCAGCTTGCGGGCCCCAGCCTGG - Intergenic
1178421976 21:32450582-32450604 CCTTCTGAAGTGCCCCAGGCTGG - Intronic
1178588669 21:33891094-33891116 GCTGCTGGCATCACCCTGGCAGG + Exonic
1179390539 21:40986009-40986031 TCTGCTGGGGTCACCCAGGCTGG - Intergenic
1179769441 21:43603463-43603485 GCTGGTGGCATGCCCCTGGCAGG - Intronic
1179810653 21:43866961-43866983 GGTGCTGCCCCGCCCCAGGCTGG + Intronic
1180040789 21:45278493-45278515 GCTGCAGGCGTGCCTGAGGAGGG + Intronic
1180702435 22:17788942-17788964 GCGGCTGGAGCGCCCCTGGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181040265 22:20188675-20188697 GCCCCTGGCATGGCCCAGGCTGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181081452 22:20418425-20418447 GCTGCTCGGGAGGCCCAGGCAGG + Intergenic
1181130545 22:20729085-20729107 GCTGCTGCAGCACCCCAGGCAGG + Intronic
1181402825 22:22661631-22661653 GCTGCTGTCGTCCTCCAGCCCGG + Intergenic
1182351429 22:29702245-29702267 GCTGCTGAGGTGTCCCAGGCAGG + Intergenic
1183481439 22:38067730-38067752 GCTGCAGGCGGACCCCAAGCAGG + Exonic
1183699865 22:39445176-39445198 GCTGGTGGCCTGGTCCAGGCTGG - Intergenic
1183934806 22:41256016-41256038 GGTGCTGGCGTCCCTCAGGTAGG - Exonic
1184021159 22:41822460-41822482 CCTGCTGACCTGACCCAGGCTGG + Intronic
1184281022 22:43437626-43437648 GCTGCTGTGGTCACCCAGGCAGG - Intronic
1184473225 22:44707460-44707482 GCTGCCGGCATGCCCTTGGCGGG + Intronic
1184973281 22:48043096-48043118 GCTGCTGGCAGGACCCTGGCAGG + Intergenic
1185168652 22:49278074-49278096 GCCACTGGCCTGCCCCAGGCAGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950469293 3:13174624-13174646 GCTGGTGGCCTGGCCCAGGCAGG - Intergenic
950476601 3:13219009-13219031 GCTGCTGGCCTGGACCAGGGTGG - Intergenic
952180331 3:30910204-30910226 GCTGCTGGCCTGCGGCAGCCTGG + Intergenic
952316683 3:32238414-32238436 GCTGCGGGCCTGGGCCAGGCGGG + Intergenic
952788257 3:37176601-37176623 GCTGCTGGCGGGGCGGAGGCCGG + Intronic
952972284 3:38659184-38659206 GCTGCTTGCGGGCCCTGGGCAGG - Intergenic
953627817 3:44585209-44585231 GCTGCTCGCTTGGACCAGGCTGG + Intronic
953749959 3:45601437-45601459 GCTGCTGGGGTGCGGCAGGCAGG - Intronic
957049307 3:75398974-75398996 CCTTCTGAAGTGCCCCAGGCTGG + Intergenic
959056713 3:101574412-101574434 GCATCGGGCGTGCCCGAGGCAGG - Intronic
961688205 3:128650296-128650318 GGTGCTGACGTGGCCCAGGCAGG + Intronic
961881628 3:130065455-130065477 CCTTCTGAAGTGCCCCAGGCTGG + Intergenic
965783863 3:172316117-172316139 GCTGCTCGAGTGGCCGAGGCAGG - Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968166206 3:196467268-196467290 GCTGCTGGGGAGGCTCAGGCCGG - Intergenic
968596776 4:1489904-1489926 CCTGCAGACGTGCCCCAGCCAGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968655296 4:1775964-1775986 GCTGCTCGGCTGCCCCGGGCAGG + Intergenic
969822285 4:9730027-9730049 CCTTCTGAAGTGCCCCAGGCTGG - Intergenic
974761691 4:66285078-66285100 GCACCTGGCTTGCCCTAGGCGGG - Intergenic
978983841 4:114984206-114984228 GCTGATGGAGTCACCCAGGCTGG + Intronic
979099506 4:116598268-116598290 GGTGCTGGTGTGCCGCAGCCAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
981172163 4:141637059-141637081 GCTGCTGGCTAGCGCAAGGCGGG + Exonic
981235101 4:142406228-142406250 GCTGGTGGCTTGCTGCAGGCTGG + Intronic
983379982 4:166980561-166980583 GCTCCTGGCTTGCCCTTGGCAGG - Intronic
983938936 4:173522237-173522259 GCTGCCGGCCTGGCCCAGGGAGG + Intergenic
985524465 5:394994-395016 CCTGCTGTCGCCCCCCAGGCAGG + Intronic
985667543 5:1189420-1189442 GCTGATGGCTTCCCACAGGCAGG + Intergenic
985872552 5:2568865-2568887 GCTGATGGTGTGGCCCATGCAGG + Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
986733056 5:10649363-10649385 GCTGCTGGAGCGCCCCTGCCCGG + Exonic
988384271 5:30540340-30540362 CCTGCCGGCCGGCCCCAGGCAGG - Intergenic
995015271 5:107302515-107302537 GCTGATGGGGTGACCCAGGGTGG + Intergenic
997194004 5:131965608-131965630 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
997363374 5:133309629-133309651 GCAGCTGGCCTGGCCCTGGCTGG - Intronic
998184382 5:139967482-139967504 GCTGCTGCCGTGCACAAGGTGGG + Intronic
999787564 5:154905809-154905831 GCTACTGGCGAGGCTCAGGCAGG - Intronic
999790732 5:154937665-154937687 GGGGCTGGCGCGCACCAGGCTGG + Intronic
1000336485 5:160245248-160245270 GCTGCTGGGGAGCCGAAGGCAGG + Intergenic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1002467409 5:179414466-179414488 CCTGCTGTCGGGCCACAGGCAGG + Intergenic
1006313718 6:33278400-33278422 CCTGCTGACGTCCCACAGGCTGG + Exonic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1008378634 6:50819701-50819723 GCGGCTGGCGTCCTCCTGGCTGG - Intronic
1010723265 6:79307940-79307962 GCTGAGGGCGTCCTCCAGGCAGG + Intergenic
1016368417 6:143343472-143343494 GATGCTGGCGTCTTCCAGGCGGG - Intergenic
1016830577 6:148429629-148429651 GCTGCTTGGGAGCCTCAGGCGGG + Intronic
1017809472 6:157974576-157974598 GCTGCTGCCGTTGCCCAGGGTGG - Intergenic
1017944323 6:159081187-159081209 GCTGCTGGGGTGGCTGAGGCAGG + Intergenic
1019281797 7:204274-204296 GCTGCTGGCCCGCCTGAGGCTGG + Intronic
1019294872 7:268697-268719 CCTGCTGGCGTGTCCCAGGACGG - Intergenic
1019420286 7:947697-947719 GCTGCTGCAGTGACCGAGGCCGG - Intronic
1019427519 7:984498-984520 GGCGCTGGCGGGCCCCGGGCAGG + Exonic
1019553129 7:1613648-1613670 GCTGCTAGGGAGGCCCAGGCAGG + Intergenic
1019601681 7:1886848-1886870 GCTGCTGGCCTGGGCCAGGAAGG - Intronic
1019644664 7:2122653-2122675 GACGCTGGCCTGCTCCAGGCAGG + Intronic
1020316564 7:6909473-6909495 CCTTCTGCAGTGCCCCAGGCTGG + Intergenic
1021828060 7:24573788-24573810 GCTGCTGGCCGCCCCCAGCCCGG + Intronic
1021891969 7:25194895-25194917 GCTGCTCCCCTGCCCCAAGCTGG - Intergenic
1022385617 7:29896195-29896217 GCTGCTGGGGAGGCTCAGGCAGG + Intronic
1022454637 7:30547567-30547589 GCTGCTGGCCTGCCAATGGCAGG + Intronic
1022856624 7:34321347-34321369 GCTGCGGGCGCCTCCCAGGCCGG - Intergenic
1023059057 7:36311988-36312010 GCTGCTGGCGTCTGCCAGGTGGG - Intergenic
1023425936 7:40036050-40036072 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1024249983 7:47498836-47498858 CCTGCTGGCATTCCACAGGCTGG - Intronic
1024639154 7:51316168-51316190 CCTGCGGGCTTGCCCCTGGCCGG - Intronic
1024726881 7:52207929-52207951 GCTGCTGGGGAGGCTCAGGCAGG + Intergenic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1028339866 7:89705269-89705291 GCTCCTGTCTTCCCCCAGGCTGG - Intergenic
1029553342 7:101250570-101250592 GCTGCTGGTGTACTCCAGGGAGG - Intronic
1029710942 7:102299583-102299605 GCTGCTGGAGTGCTGCATGCAGG + Intronic
1030484363 7:110148182-110148204 GCTCCTGGCTTGCCCTTGGCAGG - Intergenic
1032262718 7:130349979-130350001 ACTTCTGGCGTGGCCCAGCCAGG + Exonic
1033008239 7:137590802-137590824 GCTGCTCGCGTGGCGGAGGCTGG - Intronic
1033361385 7:140640868-140640890 GCAGCTGGCGGGCGCCCGGCCGG + Intronic
1033622020 7:143070123-143070145 GCTGATGGTGTGCCCCAGCAGGG + Intergenic
1034298782 7:149996914-149996936 GGTGCTGGCGTGGCCCCGGGTGG - Intergenic
1034418784 7:150978370-150978392 GCTGCGGGCGCGCGGCAGGCGGG - Intergenic
1034477866 7:151298013-151298035 GCTGCTGGCTTTGCTCAGGCTGG + Intergenic
1034534720 7:151719667-151719689 GCTGTGGGCGGGACCCAGGCAGG - Intronic
1034560170 7:151875427-151875449 GCAGCTGGCATGGCCGAGGCAGG - Intronic
1034807235 7:154099867-154099889 GGTGCTGGCGTGGCCCCGGGTGG + Intronic
1034964424 7:155382653-155382675 GCGGCTGGCAGGCTCCAGGCAGG + Intronic
1034974325 7:155439096-155439118 GCTGCGGTGGTGCCCCAGGAGGG + Intergenic
1035022880 7:155809394-155809416 GCGGCAGGGGAGCCCCAGGCCGG - Intronic
1035238904 7:157517473-157517495 GCTGGTGTTTTGCCCCAGGCAGG + Intergenic
1035622000 8:1042134-1042156 GTTGCTGGCTTTCCCCAGCCAGG - Intergenic
1036692036 8:10950177-10950199 GCTGCTGGCCTGCGACAGGGTGG - Intronic
1037882840 8:22581275-22581297 GAGGCTGGCTTGACCCAGGCCGG - Intronic
1040951288 8:52940785-52940807 GCTGTTGGCGTAGCTCAGGCTGG - Exonic
1041068025 8:54101475-54101497 GCTGACGCCGTGCCCTAGGCCGG + Intronic
1044006196 8:86940158-86940180 GTTGCTCTTGTGCCCCAGGCTGG + Intronic
1044461658 8:92452352-92452374 GCAGCTGCCCTGCCCCAGCCTGG + Intergenic
1045300599 8:100907389-100907411 GCACCTGGCTTGCCCCTGGCAGG - Intergenic
1045515899 8:102861255-102861277 GCTGCTCTTGTCCCCCAGGCTGG + Intronic
1046931151 8:119843198-119843220 GCTGCTAGGGAGCCCGAGGCAGG - Intronic
1048745066 8:137605472-137605494 GCTAGTGGCTTACCCCAGGCAGG - Intergenic
1048926611 8:139277628-139277650 GGTGCTGGGGTGCCCTGGGCAGG + Intergenic
1049032319 8:140047102-140047124 GAGGCTGGCGGGGCCCAGGCAGG - Intronic
1049687851 8:143946103-143946125 GCGGGAGGAGTGCCCCAGGCTGG + Intronic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1056798117 9:89673242-89673264 GCTGAGAGCATGCCCCAGGCTGG + Intergenic
1057216137 9:93229946-93229968 GCTGCTGGGGTGGTCCTGGCTGG + Intronic
1057670030 9:97078529-97078551 GCTGCTGTCTGGCCCCGGGCAGG + Intergenic
1060221349 9:121765691-121765713 GGGCCTGGCCTGCCCCAGGCTGG + Intronic
1060930451 9:127486457-127486479 GCTGCTGGCCTGTCCCTGTCTGG - Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061792259 9:133064905-133064927 GGCGCTGCCCTGCCCCAGGCTGG - Intronic
1062209434 9:135355826-135355848 GCAGCTGGTGGGCCCCAGGTGGG - Intergenic
1062578598 9:137220000-137220022 GCTGCTTGTGTGCGCCTGGCAGG - Intergenic
1186216673 X:7308066-7308088 CCTGCTGGACTCCCCCAGGCAGG - Intronic
1187366059 X:18666686-18666708 GATGCTGGCTTGGCCCAGGGTGG + Intronic
1187670245 X:21659008-21659030 GCAGCTCGCGTCTCCCAGGCTGG + Intergenic
1188826147 X:34837904-34837926 CAGGCTGGAGTGCCCCAGGCTGG + Intergenic
1189757089 X:44282940-44282962 GCTGCTGGCCTGACCCAGGCTGG + Intronic
1189892825 X:45623349-45623371 GCTGCTGAACTGCCCAAGGCAGG - Intergenic
1190598262 X:52067082-52067104 GCCTCTGGTGTGCCCCAGACGGG - Exonic
1190610562 X:52186991-52187013 GCCTCTGGTGTGCCCCAGACGGG + Exonic
1194451148 X:94046005-94046027 GCTGCTGGAGTGCCCCGGCTAGG + Intergenic
1194744658 X:97615143-97615165 GGGCCTGGCCTGCCCCAGGCTGG + Intergenic
1199682952 X:150240087-150240109 GCTGCTGCCCTGACCCAGGAGGG - Intergenic
1200036360 X:153334223-153334245 GGCGCTGGCGCGGCCCAGGCAGG - Exonic
1200068775 X:153517802-153517824 GCTGCGGGCGGGCGTCAGGCGGG - Intronic
1200118290 X:153778757-153778779 CATGCTGGCGGGGCCCAGGCTGG + Intronic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic