ID: 1050338670

View in Genome Browser
Species Human (GRCh38)
Location 9:4614240-4614262
Sequence GTGAACAATGGGAGTACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050338670_1050338674 18 Left 1050338670 9:4614240-4614262 CCTTTAGTACTCCCATTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1050338674 9:4614281-4614303 ACCTTGTCCATTAAAACCTTGGG No data
1050338670_1050338673 17 Left 1050338670 9:4614240-4614262 CCTTTAGTACTCCCATTGTTCAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1050338673 9:4614280-4614302 TACCTTGTCCATTAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050338670 Original CRISPR GTGAACAATGGGAGTACTAA AGG (reversed) Intronic
905822376 1:41003616-41003638 CTGTAAAATGGGAGTAATAAAGG + Intronic
907602039 1:55781734-55781756 GTGAACAGGGGCAGTACTACAGG - Intergenic
916073710 1:161187738-161187760 GTGAAGAATGGGGGAACCAAAGG - Exonic
916665150 1:166959961-166959983 GTGAACACTGGCACTAATAAAGG - Intronic
917085433 1:171299981-171300003 GTGAGCAATGGCAGTAGCAATGG - Intergenic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
1062822366 10:544091-544113 GTGAAAGATGGCAGTACCAAAGG - Intronic
1063838092 10:10039599-10039621 GTGAAAAATCAAAGTACTAATGG - Intergenic
1065451839 10:25867214-25867236 CTGTAAAATGGGAGTAATAATGG - Intergenic
1065481898 10:26203719-26203741 ATGAAAAATGGGAGTAATGATGG + Intronic
1068831356 10:61498872-61498894 TTGAACAATAGGAGTAGGAAGGG - Intergenic
1068941105 10:62682175-62682197 ATGAGAAATGGGAGTACTGAAGG + Intergenic
1076302689 10:129440059-129440081 ATGGACAATGGGGGTACTGAAGG - Intergenic
1078342461 11:10508433-10508455 GTTAACAGTGGGGGTAATAATGG + Exonic
1080099144 11:28439191-28439213 GGGAACAATTGAAGTCCTAAAGG + Intergenic
1081898565 11:46608392-46608414 GTGGACAGTGGGAGTAATTATGG - Intronic
1085454304 11:76657018-76657040 GTGAAGAGTGGGAGGACGAAGGG + Intergenic
1086553971 11:88087780-88087802 GTGAACAATGAGAGTACCTAGGG + Intergenic
1087614670 11:100474271-100474293 GTGTAAAATGGGAGTGTTAAGGG - Intergenic
1087735507 11:101828063-101828085 GTAAAAAATGAGAATACTAAGGG - Intronic
1093386135 12:18556803-18556825 GTGAACACTGGGATGAATAATGG + Intronic
1099014445 12:77327327-77327349 GTGAACAGTGATAGTAGTAATGG + Intergenic
1105302137 13:19145034-19145056 CTAAACAATGGAAATACTAAAGG + Intergenic
1107859435 13:44646918-44646940 CTGAAAAATGGGAGTACAATAGG - Intergenic
1108198661 13:48020580-48020602 TTGAACAATGGGTTTCCTAATGG - Intergenic
1111424598 13:88063403-88063425 TTGAACAATGTGGGTATTAAGGG - Intergenic
1112673841 13:101674350-101674372 GTAAACTATGGAAGTACTCAGGG - Intronic
1112733829 13:102395629-102395651 GTGAACTATGGGACTACAAAGGG - Intronic
1112985490 13:105444268-105444290 TTGAACAATGGCAGTAATATGGG + Intergenic
1113203354 13:107890382-107890404 GTGAAGAAAGGGAGTAGTAGGGG + Intergenic
1114841503 14:26267831-26267853 GAGAATAATGGGAGTGCTTATGG + Intergenic
1115759893 14:36569440-36569462 GTGAAAGATGGAAGGACTAATGG + Intergenic
1117851225 14:59971879-59971901 GTGAAAAATGGAAGAACTAGAGG - Intronic
1118870186 14:69734827-69734849 CTGAACAATGGCAGTGATAAAGG + Intronic
1119433804 14:74585165-74585187 GTGAACAAGGGGAGTGTTCATGG - Intronic
1120984768 14:90324939-90324961 GGGAGCAATGGCAGGACTAACGG + Intronic
1123912112 15:24978165-24978187 GTGAAAAATGGTAGAAATAAAGG - Intronic
1126048538 15:44666621-44666643 GGGGACAATGGTAGTAGTAACGG - Intronic
1129805293 15:78451577-78451599 GTAAACAATACGAGTACTACAGG + Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1136255427 16:29035800-29035822 GCGTACAATGGGAGTGCCAATGG - Intergenic
1139750921 16:69108320-69108342 TAGCACAATGGGAGTTCTAATGG - Intronic
1140365104 16:74375104-74375126 GCGTACAATGGGAGTGCCAATGG - Intergenic
1143092831 17:4459144-4459166 GACAACACTGGGCGTACTAAGGG - Intronic
1148127044 17:45242293-45242315 GTGAGCACTGGGGGTACTACTGG - Intronic
1149031554 17:52088503-52088525 GTGAATAATGGAAGAACAAAAGG - Intronic
1150473784 17:65459078-65459100 GTGAACAATGTGTGTACCTAAGG - Intergenic
1153668302 18:7385980-7386002 GTGTCAATTGGGAGTACTAATGG + Intergenic
1155566156 18:27136579-27136601 TTGAAAAATGGGAATACTAATGG + Intronic
1157984789 18:52424722-52424744 GTTCACAATGGGAGAACTGATGG + Intronic
1168584913 19:57584249-57584271 CTGAACAGTGGGGGTTCTAAGGG + Exonic
925176677 2:1789689-1789711 ATGAACAATGGGGGCCCTAAAGG + Intronic
925440279 2:3879630-3879652 GAGAACAATGGGTGAACTCAAGG + Intergenic
926384019 2:12318078-12318100 GTGTACAAGGGGAGCAGTAAAGG - Intergenic
929920026 2:46165262-46165284 GTGAACAAGAGGAATACAAAAGG - Intronic
930892498 2:56407303-56407325 GCTAGCAATGGAAGTACTAATGG - Intergenic
931068714 2:58619665-58619687 GTTGACAATGGGAGGATTAAGGG + Intergenic
932775409 2:74525433-74525455 GTGGACAAAGGGAGGACAAAGGG - Intronic
939456703 2:142446368-142446390 TGGAACAATAGGAGCACTAAGGG + Intergenic
943148742 2:184081833-184081855 GTGAACAAGGGGAGAACTTCAGG + Intergenic
943288386 2:186034896-186034918 GTAAACTATGTGAGTACTCAGGG + Intergenic
944659472 2:201909168-201909190 CTGAACAATGGCAGTATTGATGG - Intergenic
1172067145 20:32229629-32229651 CTGAACAGTGGCAGTACTAACGG - Intronic
1173435916 20:43032089-43032111 GTGTAAAATGGGAGTGATAATGG - Intronic
1173553000 20:43946381-43946403 GGAAACAATGGGAGCAGTAATGG + Intronic
1174278336 20:49419908-49419930 GTGAGCAAGGGGAGGAGTAAAGG - Intronic
1175639372 20:60614697-60614719 GGGAACAATAGTAGTCCTAAAGG - Intergenic
1177659604 21:24065437-24065459 GTGAACAAAGGGTGAACAAAGGG + Intergenic
1183984914 22:41564107-41564129 AAGAAGAATGGGTGTACTAATGG + Intronic
950637272 3:14323948-14323970 CTGTACAATGGGGGTAATAACGG - Intergenic
955728983 3:61963818-61963840 CTAAACAATGGAAATACTAAAGG + Intronic
956232064 3:67028713-67028735 GTGTACTATGGGAGCACAAAGGG - Intergenic
959553205 3:107687696-107687718 GTGAACTATGGGACCAATAATGG - Intronic
967280693 3:187820573-187820595 TTGAACAATGTGAGGATTAAGGG - Intergenic
969919014 4:10519488-10519510 GTCAGGAATGGGAGTCCTAAAGG - Intronic
970101776 4:12531449-12531471 GTGCCTAATGGGTGTACTAAGGG - Intergenic
971075950 4:23149945-23149967 TTGAACAATGGGACGATTAAGGG + Intergenic
974422347 4:61693566-61693588 GTCAAGGATGTGAGTACTAATGG - Intronic
975047117 4:69819231-69819253 GTAAAATATGTGAGTACTAAAGG - Intronic
975796159 4:78008560-78008582 GTTAACAGTGGGGGTAATAATGG + Intergenic
976072983 4:81262929-81262951 GTGAAAAATGTGAGTACATATGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976892439 4:90066433-90066455 ATGAATAATGGGAACACTAATGG - Intergenic
980059520 4:128114101-128114123 GTGAAAAGTAGGAGTAATAATGG + Intronic
987736564 5:21852737-21852759 GTGAAGAAAGAGAGTATTAAAGG - Intronic
992836871 5:80650292-80650314 GTTAACAGTGGGGGTAATAATGG + Intronic
995297142 5:110535676-110535698 GTGAACTCTGGAATTACTAAGGG + Intronic
995736729 5:115309008-115309030 GTGAACAATGTGAGAACTTGTGG + Intergenic
996690565 5:126335783-126335805 GTGATCAATGGGAGTTATAATGG + Intergenic
996716908 5:126595371-126595393 TGGAACAATGGGAGTGCTACAGG + Exonic
999753119 5:154645154-154645176 GTGCAAAATGGGAGTAGTACTGG - Intergenic
1001837218 5:174842596-174842618 AGGAACAATGGGAGTGCAAATGG - Intergenic
1003584122 6:7370810-7370832 GTGAAAAATGAGAGTAAAAAGGG + Intronic
1007120324 6:39375293-39375315 GTGAACACAAGGAGTAATAATGG + Intronic
1008068191 6:47073112-47073134 ATGAACAATGGTGGTAATAAAGG + Intergenic
1008679169 6:53854004-53854026 GTGACCAATGTGAATGCTAATGG - Intronic
1009547415 6:65037746-65037768 TTGAACAATGTGGGAACTAAGGG - Intronic
1010468637 6:76198941-76198963 GTTAAGAATGGGAGGACAAATGG + Intergenic
1013874973 6:114814108-114814130 GTGAGCAAAGGGAGCAATAATGG + Intergenic
1015303699 6:131682579-131682601 GTCAACACTTGGAGTACAAATGG - Intronic
1016130312 6:140460297-140460319 GAGAAAAATGGGAGTAATGATGG - Intergenic
1018096244 6:160389641-160389663 ATCAACACTGGGAGTACAAATGG - Intronic
1022580304 7:31546819-31546841 CTGAACTATGGGATTACAAAGGG + Intronic
1024819101 7:53306055-53306077 GTGAACCCTCGGAGGACTAAGGG + Intergenic
1028339709 7:89703629-89703651 TTGTACAATGGGACTAATAATGG + Intergenic
1031889670 7:127279486-127279508 TTGAACGATGGGAGGATTAAGGG - Intergenic
1033963386 7:146943030-146943052 TTGAACAATGTGAGAATTAAGGG + Intronic
1046081757 8:109378216-109378238 GTGAAAAATGGGATAAATAATGG - Intronic
1046937931 8:119903655-119903677 GTCAACTATGAGAGTACTTATGG + Intronic
1048822211 8:138391021-138391043 ATGAAGAATGGGAGTATTCAGGG + Intronic
1050338670 9:4614240-4614262 GTGAACAATGGGAGTACTAAAGG - Intronic
1050493028 9:6209574-6209596 GTGGACAATGAGAGTCCTATAGG - Intergenic
1051798246 9:20900632-20900654 GTGAACATTGTGAATAATAATGG + Intronic
1054862165 9:69965251-69965273 GTGAACAATGGTTGAACTGAGGG - Intergenic
1054922592 9:70556809-70556831 CTGTAAAATGGGAGTAATAATGG + Intronic
1186680358 X:11867304-11867326 GTTAATAATGGAAGTACAAAAGG - Intergenic
1186927739 X:14353682-14353704 GTGAAGAATGGGAATAATAATGG - Intergenic
1187676111 X:21718206-21718228 CTGAACAATTGGAGCATTAATGG - Intronic
1191991896 X:67046802-67046824 CTGAAAAATGGGAATACTAGTGG + Intergenic
1192588476 X:72339781-72339803 GGGAACAATTGCAGTACCAAGGG + Intronic
1194582674 X:95696145-95696167 GTGAAAAATGGGGATAATAAGGG + Intergenic
1195021406 X:100832349-100832371 GTGTAAAATGGGACTAATAATGG - Intronic
1195593666 X:106662524-106662546 GAGAAGAATGGGAGAACTAAGGG + Intronic
1198262311 X:134975794-134975816 GAGAACATTGGTAGCACTAAGGG - Intergenic
1198556401 X:137798231-137798253 TTGAACAATGAGAGTGCTATCGG + Intergenic
1198694096 X:139317205-139317227 GGGAATAAGGGGAGTAATAAAGG - Intergenic