ID: 1050339329

View in Genome Browser
Species Human (GRCh38)
Location 9:4620198-4620220
Sequence GTTATGAGAAGGAGGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050339329_1050339337 7 Left 1050339329 9:4620198-4620220 CCTCATAACCTCCTTCTCATAAC 0: 1
1: 0
2: 0
3: 9
4: 183
Right 1050339337 9:4620228-4620250 CCCTGTGGATTCATAACATGTGG No data
1050339329_1050339332 -8 Left 1050339329 9:4620198-4620220 CCTCATAACCTCCTTCTCATAAC 0: 1
1: 0
2: 0
3: 9
4: 183
Right 1050339332 9:4620213-4620235 CTCATAACCTCCTTCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050339329 Original CRISPR GTTATGAGAAGGAGGTTATG AGG (reversed) Intronic
900917453 1:5648783-5648805 CTTATGAGATGGAGGCTATGCGG - Intergenic
905346213 1:37312863-37312885 GTTAAGAGATGGAGGTTGTTTGG - Intergenic
906087615 1:43149163-43149185 GCTATGAGAAGGATTTTAGGTGG - Intronic
906309957 1:44746688-44746710 GTGATGAGAATGAGGTGAAGAGG - Intronic
910489069 1:87747990-87748012 GTTATGAGAAAGAGATTTAGGGG + Intergenic
911411363 1:97511615-97511637 TTTATGAGAAGGGTGATATGGGG + Intronic
913099690 1:115551727-115551749 GTGAGGAGAAGGAGGTTTGGTGG - Intergenic
914360839 1:146934564-146934586 ATTATGGGATGGAGGTGATGCGG - Intergenic
914491746 1:148156073-148156095 ATTATGGGATGGAGGTGATGCGG + Intergenic
919058509 1:192600981-192601003 ATGCTGAGAAGGAAGTTATGTGG - Intergenic
921028760 1:211317558-211317580 GTTATGATAAAGAAGTTGTGGGG - Intergenic
921130918 1:212218967-212218989 CTTATGATAAAGAGCTTATGAGG - Intergenic
921727504 1:218539830-218539852 TTTATAAGAATGGGGTTATGGGG - Intergenic
923384398 1:233452292-233452314 GTTAAGGTAAGGAGGTTGTGGGG - Intergenic
924014878 1:239710524-239710546 CATATGAGCAGGAGGGTATGAGG + Intronic
1063187276 10:3662905-3662927 GGTTTGAGATGGAGGTCATGAGG - Intergenic
1063953612 10:11246517-11246539 TTTATCAGAAGTAGGTTCTGTGG - Intronic
1065758519 10:28958852-28958874 GTAGGGAGAAGGAGGTTAAGGGG + Intergenic
1067780748 10:49204839-49204861 GTTATGAGAATAAGGTCAGGAGG - Intergenic
1072904357 10:99438004-99438026 TTTATGAGAAGGAAATTATCAGG + Intergenic
1074445457 10:113517855-113517877 GTTTTGAGCAGGAGCTGATGTGG - Intergenic
1074851764 10:117444807-117444829 GCTATGAGATGGCGGTGATGTGG - Intergenic
1078938666 11:15976227-15976249 CTTCTGGGAAGAAGGTTATGTGG + Intronic
1080089880 11:28334876-28334898 ATTATGAGAAGGAAGTGAGGTGG - Intergenic
1091004008 11:131935573-131935595 GTTAAGAGAAGGGTGTCATGAGG + Intronic
1091141702 11:133240764-133240786 CTAAGGAGAAGGAGGTGATGAGG - Intronic
1094027609 12:25975397-25975419 GTTATGAGAAGCAGCTTTTCCGG + Intronic
1097835455 12:64268543-64268565 GTTAGGAGGAGGAGAATATGTGG + Intronic
1100393352 12:94163484-94163506 GGGAGGAGAAGGAGGTTGTGGGG + Intronic
1102284604 12:111645506-111645528 GCTGTGATAAGGAAGTTATGAGG + Intronic
1103016348 12:117497578-117497600 GTTATAAGAAGCATGTAATGAGG - Intronic
1104489329 12:129180589-129180611 GATTTGTGAAGGAGATTATGGGG + Intronic
1105340127 13:19515304-19515326 ATTGTGAGAAAGAGGTTCTGTGG - Intronic
1107362583 13:39636132-39636154 CTTATGGGAAGCAGGTTTTGTGG - Intergenic
1107379471 13:39840547-39840569 TTTATGAGAATGAAGTCATGTGG + Intergenic
1108151620 13:47541796-47541818 GTTATGAAATGGAGAATATGAGG + Intergenic
1108886299 13:55187094-55187116 ATTAGGAGAAGGAGCATATGGGG + Intergenic
1109900770 13:68766484-68766506 ATTATGAGAATGAGTTTATATGG + Intergenic
1110314752 13:74092969-74092991 GTTGTGAGAAGGAAGTTGTCTGG - Intronic
1111610433 13:90599669-90599691 CTTATGGGAAGGAGTTTGTGTGG + Intergenic
1111641086 13:90971430-90971452 GTTATGAGAGAGAGCATATGAGG + Intergenic
1112432411 13:99361729-99361751 GTTATGTGAAGGAGGGGAGGGGG - Intronic
1120259903 14:82169513-82169535 GGTATGGTAATGAGGTTATGAGG + Intergenic
1120283710 14:82470641-82470663 GGTATGAGGAGGAGGTGAGGAGG + Intergenic
1121158494 14:91710908-91710930 ATAATGAGGTGGAGGTTATGAGG - Intronic
1123986810 15:25653557-25653579 GTTAAGATAAGGGGGTTGTGGGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124096372 15:26652096-26652118 GTTAAGATAAGGGGGTTGTGGGG - Intronic
1126541139 15:49825449-49825471 GTTATGTTAAGGAGGTGAGGTGG + Intergenic
1128081961 15:64862142-64862164 GGTCTGAGAAGGGGGTTGTGGGG + Intronic
1128246988 15:66139851-66139873 GTTATGAGGAGGAAGTCAGGGGG + Intronic
1129028895 15:72604628-72604650 GTTCTGAGAGGGAGGTTGTGGGG + Intergenic
1131176408 15:90212121-90212143 GTTCTGAGTAGGAAGTGATGTGG - Intronic
1131506196 15:93021952-93021974 GTTATGAGTTGCAGGTTATTTGG + Intronic
1131964915 15:97831501-97831523 GTGATGAAAAGCAGGTGATGAGG - Intergenic
1132502610 16:291276-291298 GGTATGTGCAGGAGGTTATGCGG - Exonic
1138812299 16:60165460-60165482 GATATGAGAAGGAATTTATTAGG + Intergenic
1140919095 16:79520368-79520390 GTGATGAGAAGGAGGTCATATGG - Intergenic
1142495344 17:303454-303476 GTTATAAGAAAGAGGTTGGGGGG + Intronic
1147775332 17:42896882-42896904 GTTATGGGAAGGAGGAGAAGAGG - Intergenic
1148890742 17:50805548-50805570 GTTCTGAGGAGGAGGTGAGGAGG + Intergenic
1150860509 17:68796183-68796205 GTTGTTAGAAGGAGCTTTTGTGG + Intergenic
1154486254 18:14873661-14873683 TTTATGAAATGGAGGTCATGGGG + Intergenic
1156106249 18:33666014-33666036 GTTATGAGAAGGAGTATAATTGG - Intronic
1158161365 18:54488205-54488227 ATTATGAGAAGACGGTTTTGTGG + Intergenic
1159632291 18:70762942-70762964 GTTATATAAAGGAGGTTTTGTGG + Intergenic
1161732109 19:5967520-5967542 GATATGAGGAGGATGTCATGGGG - Intronic
1167566601 19:50261203-50261225 GTTATAGGAAGGGGGTGATGGGG - Intronic
1167831218 19:52024244-52024266 GATCTGAGAAGGGGGTTGTGGGG + Intronic
928241752 2:29592538-29592560 GTGAGGAGAAGGAGGCTTTGTGG - Intronic
928328104 2:30335959-30335981 GTTATCAGGAGGAGTATATGAGG + Intergenic
931235323 2:60407772-60407794 GTGATGAGAAGGACGTTCTTGGG - Intergenic
933215129 2:79621001-79621023 TTTAACAAAAGGAGGTTATGGGG - Intronic
933329132 2:80875159-80875181 GTTAACATAAGGATGTTATGTGG - Intergenic
933753810 2:85621374-85621396 GTTTTCTGAAGGATGTTATGTGG + Intronic
935187277 2:100745604-100745626 TATATGAGAAGGAGTTTATTAGG + Intergenic
937135180 2:119545552-119545574 GTGATGAGGAGGGGGTGATGAGG - Intronic
937543100 2:122983453-122983475 GATATGAGAAGGAGGGAGTGTGG - Intergenic
937790731 2:125958210-125958232 GATGAGAGAAGGTGGTTATGGGG - Intergenic
940309193 2:152259072-152259094 GTTATGAGAAGGAAATAATCAGG - Intergenic
945499714 2:210556541-210556563 GTTAAGAGAAGGAGGAGCTGTGG + Intronic
946318843 2:218936439-218936461 GTTTTGGGAAGGAGGGAATGTGG + Intergenic
948440070 2:237981026-237981048 TCTATCAGAAGGAAGTTATGCGG + Intronic
948469654 2:238168699-238168721 GTTTTGATAAGGGGGTGATGTGG + Intronic
1168973171 20:1944914-1944936 GTGATGAGAAGGAGGATGAGAGG + Intergenic
1170360217 20:15537774-15537796 GTTGTGAGAAGAAGGGTAAGTGG - Intronic
1170498944 20:16954816-16954838 GATATCAGAAGGTGGTTTTGGGG - Intergenic
1173102810 20:40103384-40103406 TTTATAAGAAGGAGGATATGTGG - Intergenic
1173723354 20:45279287-45279309 GTGATGAGAAGGTGGTGGTGGGG - Intergenic
1175128610 20:56772003-56772025 GCTGTGAGAAGAAGGATATGAGG - Intergenic
1176795048 21:13365718-13365740 TTTATGAAATGGAGGTCATGGGG - Intergenic
1178902368 21:36607530-36607552 GTTATTACATGGAAGTTATGAGG - Intergenic
1182409563 22:30171931-30171953 GGTATGAGAAGCAAGATATGAGG + Intronic
1183155554 22:36072248-36072270 GTTTTTAGAAGGAGGGTTTGGGG + Intergenic
1185233007 22:49694076-49694098 GTTCTGAGCAGGAGGATCTGGGG + Intergenic
950244471 3:11403376-11403398 GTAAGGAGAAGGAGATTAAGAGG + Intronic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
951669904 3:25169168-25169190 GTTTTCTGAAGGATGTTATGTGG - Intergenic
952804786 3:37338738-37338760 GTTACGGGGAGGAGGTAATGGGG - Intronic
954875411 3:53800002-53800024 GTTTTGCAAAGGAGGTTACGGGG + Intronic
957559632 3:81805840-81805862 GTTATGAGAAAAAGTTTGTGAGG + Intergenic
958648228 3:96900798-96900820 GTTATGAGGAGGAGGACAGGAGG + Intronic
958940260 3:100304291-100304313 TTTAGGGGAAGGAGGTTCTGAGG + Intronic
962005766 3:131348027-131348049 GTTATGGGAATGAGATTATTAGG - Intronic
962167049 3:133060254-133060276 GGTCTGAGAAGGCTGTTATGAGG + Intronic
963286142 3:143436264-143436286 CCTGTGAGAAGGAGGTCATGCGG - Intronic
963922171 3:150916301-150916323 GTTATGTGAATGTGGATATGGGG - Intronic
964356794 3:155858528-155858550 GTTATGAGAAAAAGCTTAAGGGG - Intergenic
969897690 4:10320610-10320632 GTTGTGGGGTGGAGGTTATGAGG + Intergenic
970455833 4:16223627-16223649 GTTCTGAGAACGAAGTGATGAGG + Intronic
973059141 4:45697710-45697732 GATAAGAGAAAGAGGTTATTTGG - Intergenic
973234674 4:47886896-47886918 GTCATGAGAAAGAAGTTATTGGG - Intronic
974793969 4:66724931-66724953 GTGATGAGAAGGAAGCTTTGTGG + Intergenic
976496064 4:85731155-85731177 GGTATAAGAAGGTGGTTTTGTGG - Intronic
978058673 4:104308518-104308540 ATGATTAGATGGAGGTTATGTGG - Intergenic
979449469 4:120853308-120853330 GTTATTTGAAGGAGGTCATTGGG + Intronic
984231037 4:177099348-177099370 GTGATGAGAAGGAGGTATGGGGG - Intergenic
984494454 4:180477132-180477154 TTTATGAGAAAAAGGTAATGCGG - Intergenic
984743926 4:183195377-183195399 GTGTTGAGAAGGAGGCTAAGAGG - Intronic
985174026 4:187182138-187182160 GTGATGAAAAGGAGCGTATGTGG - Intergenic
985297778 4:188454148-188454170 GTTATGAGAGGGAGGATTAGAGG - Intergenic
986227402 5:5828525-5828547 GTCATGAGAAGGAGGCCAGGTGG - Intergenic
986417680 5:7545123-7545145 GTCATAAGAAGGAGGTTACTGGG + Intronic
987735034 5:21829773-21829795 GGTAGGAGAATGAAGTTATGAGG - Intronic
987859876 5:23470968-23470990 GTAAAGAGAAGGAGGAAATGAGG - Intergenic
988586411 5:32511328-32511350 GATATGGGAAGGGGGATATGAGG + Intergenic
990618209 5:57529788-57529810 GTCAAGAGAAAGAGGTTATGAGG + Intergenic
991009474 5:61867976-61867998 GTACTGAGAAGGAGGGCATGAGG + Intergenic
993597168 5:89871735-89871757 CTTAAGAGTAGGAGCTTATGGGG - Intergenic
994261130 5:97659948-97659970 GCTTGGAGAAGGAGGTAATGGGG + Intergenic
995135965 5:108680059-108680081 GTCATGAGAAGGTGCTTTTGGGG + Intergenic
996312254 5:122120091-122120113 GTTAGGAGAAGGTGGAAATGTGG - Intergenic
1001228768 5:169967941-169967963 GTTCTGAGAAGGAGCACATGGGG + Intronic
1003830123 6:10000100-10000122 TTGATGGGAAGGGGGTTATGTGG + Intronic
1005231686 6:23709189-23709211 GCTATGTGAAGGAGGGAATGGGG + Intergenic
1005533635 6:26733515-26733537 TTGATGAGGAGGAGGTTTTGGGG - Intergenic
1005535014 6:26746176-26746198 TTGATGAGGAGGAGGTTTTGGGG + Intergenic
1005537160 6:26768139-26768161 TTGATGAGGAGGAGGTTTTGGGG + Intergenic
1006301478 6:33195667-33195689 GGTGTGAGAAGGAGGCAATGAGG + Exonic
1006781753 6:36636976-36636998 GTTTGGAGAATGAGGTTCTGAGG + Intergenic
1009008046 6:57810554-57810576 TTGATGAGGAGGAGGTTTTGGGG + Intergenic
1009243133 6:61203412-61203434 GGGATCAGAAGGAGGTTCTGGGG - Intergenic
1010455592 6:76050587-76050609 GATATGACAAGGAGATGATGTGG - Intronic
1012533569 6:100268155-100268177 GGGAGGAGAAGGATGTTATGGGG - Intergenic
1013957925 6:115861869-115861891 TTTGTGAGGAGGAGGTTATTAGG - Intergenic
1015449778 6:133352367-133352389 GTTATGAGGAGGAGCTTAAAAGG + Intronic
1018996757 6:168716079-168716101 ATGATGAGAAGGAGGAGATGGGG + Intergenic
1019988026 7:4672363-4672385 GTTATTGGCAGGAGGTCATGTGG + Intergenic
1020843724 7:13256075-13256097 AATATGAGAAGGGGGATATGAGG - Intergenic
1020900286 7:13995062-13995084 ATAATGAGAAGGAGGTGATAAGG - Intergenic
1022290241 7:28994832-28994854 AATATGAGAAGGAAGTGATGTGG + Intergenic
1022471414 7:30683711-30683733 GTTATGAGACGGAGAGTCTGGGG + Intronic
1025200158 7:56956911-56956933 CTGCTGTGAAGGAGGTTATGGGG + Intergenic
1025671787 7:63620021-63620043 CTGCTGTGAAGGAGGTTATGGGG - Intergenic
1028414045 7:90560884-90560906 GTTGTGGGAAGGAGGGAATGGGG + Intronic
1029196278 7:98807823-98807845 GTTATGAAACGGAGGTTTTCTGG + Intergenic
1030311299 7:108071871-108071893 GTTTTAAGAAGGAGATTATCTGG - Intronic
1033524099 7:142193298-142193320 GTTAAGAGAAGGAGGGAATTAGG - Intronic
1036519640 8:9479239-9479261 GTGAGGAGAAGGAGGGTCTGAGG - Intergenic
1037367705 8:18140556-18140578 GTTAAGATAAGGTGGTTGTGGGG - Intergenic
1040714652 8:50235381-50235403 TTTATGAGAACAAGGTTTTGGGG - Intronic
1042057783 8:64785387-64785409 TTTATGTGCAGGATGTTATGTGG - Intronic
1043934942 8:86132067-86132089 GTTGTGATAAGGAGGTGATAAGG - Intronic
1044588947 8:93895357-93895379 GGTAGGAGAAGGAGGTGAGGGGG - Intronic
1044931444 8:97255504-97255526 GTTATCAGAAGGTGAGTATGGGG - Intergenic
1045895427 8:107210226-107210248 GTACTGAGAAGGAGGAGATGTGG + Intergenic
1045978846 8:108160612-108160634 GTTGTGTGAAGGAGGTTTAGTGG - Intergenic
1047429684 8:124780521-124780543 GCTAAGAGAAGGAGGTGAAGCGG + Intergenic
1047613919 8:126547295-126547317 ATGATGAGAAGCAGGCTATGTGG + Intergenic
1048117098 8:131535865-131535887 GCTGTGAGAAGGAGGAAATGGGG - Intergenic
1049744982 8:144259457-144259479 GGTCTGTGAGGGAGGTTATGTGG + Intronic
1050339329 9:4620198-4620220 GTTATGAGAAGGAGGTTATGAGG - Intronic
1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG + Intergenic
1053887174 9:42652473-42652495 TTTATGAAATGGAGGTCATGGGG + Intergenic
1054226194 9:62459924-62459946 TTTATGAAATGGAGGTCATGGGG + Intergenic
1054804669 9:69386054-69386076 GTCATTTGAAGGAGCTTATGAGG + Intronic
1055354875 9:75427538-75427560 GGCATGAGAAGGAGCTTTTGAGG - Intergenic
1055591527 9:77819954-77819976 ATTATGAGAGGGAGGTAATTAGG - Intronic
1057532632 9:95865759-95865781 GTTAAGAAAAGGAGATGATGGGG - Intergenic
1059252558 9:112899195-112899217 CTTATGAAAGGGAGGTGATGTGG - Intergenic
1187093297 X:16120168-16120190 GCTTTGAGAAGAAGATTATGTGG - Intergenic
1188709895 X:33382991-33383013 ATTATGATAAGTAGGTTAAGAGG - Intergenic
1189606724 X:42685890-42685912 GTTATGAGTAGGGGTTGATGGGG + Intergenic
1189985722 X:46551707-46551729 GTTAAGATAAGGGGGTTATGGGG + Intergenic
1190289563 X:48983321-48983343 GGCATGAGAAGGAGGTGCTGGGG - Exonic
1190561831 X:51694176-51694198 TTTAAGATAAGGAGATTATGTGG + Intergenic
1191098769 X:56702433-56702455 GCTATAAAAAGGAGGTTGTGAGG + Intergenic
1196934530 X:120716435-120716457 TTTCTGAGATGTAGGTTATGGGG - Intergenic
1198010719 X:132550877-132550899 ATGATGAGAAGGATGCTATGTGG + Intergenic
1198802278 X:140460103-140460125 GTCATGATAAGGAGGTCATCAGG + Intergenic
1199579038 X:149343175-149343197 GTTGGGAGAAGGAGGTCATGAGG - Intergenic
1200283114 X:154795340-154795362 GGTAGGAAAAGGAGGTTCTGAGG + Intronic
1201988525 Y:19995938-19995960 GTTATAAGAAGGAGAATAAGAGG + Intergenic