ID: 1050340345

View in Genome Browser
Species Human (GRCh38)
Location 9:4631048-4631070
Sequence GTGTGGATTCCTTACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050340345 Original CRISPR GTGTGGATTCCTTACCAGCA GGG (reversed) Intronic
903632128 1:24783135-24783157 GTGTGGATTCCCTAAGAGTAGGG + Intronic
912623968 1:111192726-111192748 CTGTGAATTCCTTAAAAGCAGGG - Intronic
916004576 1:160647626-160647648 GTGTGGATTCCCTCCCAGGCAGG + Intergenic
916860578 1:168800276-168800298 CTGTGGATTCCTTGACAGAAGGG - Intergenic
918306522 1:183251622-183251644 GTGCGGGTTCCCTACCAGCCAGG - Exonic
923212779 1:231820582-231820604 GTCTGGGTTCCTGACAAGCAGGG - Intronic
1062843134 10:686486-686508 GTGTGGCCTCCTTACCTGCATGG + Intronic
1064991654 10:21261932-21261954 GTGTGGACTCCATTCCTGCATGG - Intergenic
1065797118 10:29318153-29318175 GTTTGGAATTCTTAGCAGCAGGG - Intronic
1066292855 10:34029711-34029733 CTGGGAATTCCTTCCCAGCAGGG - Intergenic
1066564419 10:36706201-36706223 GTGTTGATTACTGAACAGCAGGG + Intergenic
1067286963 10:44913916-44913938 GTGTGGATTTCTTAAAAGCTAGG + Intronic
1070017452 10:72547802-72547824 GTTTGGTTTCCTTAAAAGCAAGG + Intronic
1076026151 10:127115210-127115232 AGGTGGATGCCTTATCAGCATGG - Intronic
1076544817 10:131238238-131238260 GTGTGGATTCCTTAACGAGATGG - Intronic
1076897446 10:133319868-133319890 GTGTGGATTCCCTGCAAACAAGG - Intronic
1079210771 11:18458632-18458654 TTGAGAATTCCTTATCAGCAAGG - Intronic
1079931783 11:26572488-26572510 GTTTGGATTCCTCACCTGCAAGG - Intronic
1085265610 11:75236314-75236336 GCTTGGCTTCCTTGCCAGCAGGG - Intergenic
1087369812 11:97269420-97269442 GTGTACATGCCTTTCCAGCAGGG - Intergenic
1088195774 11:107272268-107272290 GTGTGGACTCCTCACCTCCAAGG + Intergenic
1089422285 11:118340869-118340891 GTCTGGATTCATTTCCAGGAAGG - Intronic
1091388978 12:113822-113844 TTGTGGATTCCTTTCTAGCTTGG + Intronic
1102344203 12:112148398-112148420 GTGTGCATTCCTTGTCAGGATGG - Intronic
1104465160 12:128984101-128984123 CTGTGGATTCCTTACGACAATGG + Exonic
1104555893 12:129799703-129799725 CTGTAGATTCCTTTACAGCAGGG - Intronic
1112100743 13:96186530-96186552 GTGTGGATGCCTTTCCACTAAGG + Intronic
1117225370 14:53653144-53653166 CTGAGGATTCCTTAAAAGCATGG + Intergenic
1118315324 14:64722548-64722570 GTGTGGATTCCTCCCCAGCTGGG + Intronic
1119061974 14:71484015-71484037 CTGTGGATTCCTCAAAAGCAGGG + Intronic
1120379744 14:83761408-83761430 GTGTAGATTTTTTACCAACATGG + Intergenic
1121657044 14:95604787-95604809 GTGTGTCCTCCTTACCTGCACGG - Intergenic
1131346210 15:91651015-91651037 GTGTGGGCTCCCTCCCAGCATGG + Intergenic
1131976745 15:97954384-97954406 GTGTGGGTTCTTTACCATCATGG - Intergenic
1132463509 16:67099-67121 CTGGCTATTCCTTACCAGCAGGG - Intronic
1133459277 16:5972821-5972843 GTTTGGCTTCCTTAGTAGCAGGG + Intergenic
1134842109 16:17410055-17410077 GTGTGAACTCATTAGCAGCAGGG - Intronic
1140706779 16:77638069-77638091 GTGCATATCCCTTACCAGCAGGG + Intergenic
1141699334 16:85635277-85635299 GTCTGGTTTCCGTACCACCAGGG + Intronic
1141699707 16:85636746-85636768 GGGGGGCTTCCTTTCCAGCAGGG - Intronic
1142186208 16:88695848-88695870 TTCTGGATTCCTTACTCGCAGGG - Intergenic
1142220363 16:88851379-88851401 GTGGGGATTCCGTTCCAACATGG + Intronic
1142960255 17:3548086-3548108 CTGTGGCCTCCTGACCAGCAGGG + Intronic
1144649778 17:17000058-17000080 CTGTGCCTTCCTGACCAGCAGGG - Intergenic
1144673607 17:17146883-17146905 ATGTGGCCTCCTAACCAGCAGGG - Intronic
1148093934 17:45039618-45039640 GTATGGAGTCCTTACCACCCTGG - Intronic
1148988350 17:51644027-51644049 GTGTGGTGCCTTTACCAGCATGG + Intronic
1153802940 18:8687045-8687067 GTGTGGCTTCCCTTACAGCATGG - Intergenic
1155030744 18:21981420-21981442 GTTTACATTCCTTACCAGCTAGG + Intergenic
1156305214 18:35873026-35873048 GTGTGGCCTTCTTACCAGCTTGG + Intergenic
1157563596 18:48664791-48664813 GCGTGGATTACTGACAAGCAGGG - Intronic
1159900663 18:74041986-74042008 GTGCGTATTACTTAGCAGCACGG - Intergenic
1167683289 19:50939270-50939292 GGGTGCAGTCCTTACCAGCAAGG - Intergenic
927565025 2:24104447-24104469 GTGTTGAGTCCTACCCAGCATGG - Intronic
929636453 2:43526626-43526648 GTGTGGACTGATTACCAGCCTGG - Intronic
931058205 2:58496452-58496474 GTGTGGATTCCCTATCTGCCTGG + Intergenic
931936832 2:67207782-67207804 GTGTGGTCTCCAAACCAGCATGG + Intergenic
932135841 2:69227837-69227859 GTGTGGCTTCCTTTGCATCAAGG - Intronic
934046766 2:88179006-88179028 CCGGGGATTCCTTACCTGCAAGG - Exonic
935097971 2:99965356-99965378 GTGCAGATGCCTTACCAACAGGG - Intronic
940134313 2:150418711-150418733 GTGCTGAGTCCTCACCAGCAAGG - Intergenic
940989422 2:160083127-160083149 GTGTAGAGTCCTTCCCAGCTTGG + Intergenic
942586874 2:177489879-177489901 GTTTTGATCGCTTACCAGCAGGG + Intronic
1169269233 20:4186725-4186747 GTCTGGCTTCCTCACCAGCATGG + Intronic
1171350823 20:24501915-24501937 CTGGGGATTCTTTTCCAGCAAGG + Intronic
1172911114 20:38409742-38409764 GTGTGCATTCTTTAAAAGCAAGG - Intergenic
1175622089 20:60456386-60456408 CTGAGGTTTACTTACCAGCAAGG + Intergenic
1175658530 20:60792641-60792663 GTGTGGGTTCCTTCCCAACACGG - Intergenic
1178353997 21:31895384-31895406 GTGTTGATTACTTATCAGCCCGG + Intronic
1178592044 21:33919223-33919245 GTGTGGACACCTGACCGGCATGG + Intergenic
1185039985 22:48498879-48498901 GTGTGGACTCAATACCAGCAGGG + Intronic
954636028 3:52071331-52071353 GTGTGGTTTCCTCAGCAGCCTGG + Intergenic
964089953 3:152863635-152863657 GGGTGTATTTCTTACCAACAAGG - Intergenic
970239380 4:13992469-13992491 CTGTGGATTCCTGGGCAGCAGGG + Intergenic
971393309 4:26205538-26205560 GTGGGGATTCCAGACCAGCCTGG + Intronic
980022924 4:127730756-127730778 GTGCGGATTCCTCGCGAGCAGGG + Exonic
982082581 4:151805310-151805332 GTGTGGAATCCTTAAAGGCAGGG + Intergenic
982149275 4:152434677-152434699 AGGTGACTTCCTTACCAGCAGGG + Intronic
982390511 4:154858268-154858290 GTGTGAATTCAATACCAGGATGG + Intergenic
983489064 4:168367425-168367447 CTGTGGAGACCTTACCATCATGG - Intronic
984422746 4:179546197-179546219 CTATGAATGCCTTACCAGCAAGG + Intergenic
988826573 5:34941959-34941981 CGGGGGATTCCTTTCCAGCAGGG + Intronic
991454684 5:66789906-66789928 GTGTGTATTTGTTAGCAGCATGG + Intronic
995969982 5:117956527-117956549 CTGTGGATTGTTTACCAGCTTGG - Intergenic
999677900 5:154023900-154023922 GTGTGGATTCTCTACAAACAGGG - Intronic
1003190444 6:3869854-3869876 CTGAGGATTCCTTCCCAGAATGG + Intergenic
1015762356 6:136677959-136677981 GGGGGAATTCCTTACCAACAAGG + Intronic
1018177194 6:161187293-161187315 GTGTGCTTTCCTCAACAGCAGGG + Intronic
1022807554 7:33837839-33837861 GTGTGCTTTCCTTCCCAGCATGG + Intergenic
1023004047 7:35843406-35843428 CTGTGGATTTCTCTCCAGCATGG + Intronic
1027484429 7:78742829-78742851 GTCAGGGTCCCTTACCAGCAAGG - Intronic
1031551483 7:123119180-123119202 CTCTGGGTTCATTACCAGCATGG - Exonic
1036408784 8:8479217-8479239 GATTGGATTCTTTTCCAGCAGGG - Intergenic
1038144278 8:24880081-24880103 GTGGGGAGTCCTCACCATCATGG + Intergenic
1040073926 8:43210870-43210892 TAGTGGCTTTCTTACCAGCATGG + Intergenic
1041175520 8:55192924-55192946 GTGTGGATGTGTGACCAGCAGGG + Intronic
1044520319 8:93191808-93191830 GTGTGGATGACTTACCATAACGG + Intergenic
1048517703 8:135125539-135125561 GTGGGGTTTCCTGACCATCAGGG + Intergenic
1050102857 9:2136631-2136653 GTTTGGATTCCTTACAGTCATGG + Intronic
1050340345 9:4631048-4631070 GTGTGGATTCCTTACCAGCAGGG - Intronic
1051784057 9:20722352-20722374 GTGTGTGTTCCACACCAGCATGG + Intronic
1055197546 9:73614819-73614841 GGGTGTACTCCTTCCCAGCAAGG + Intergenic
1055655813 9:78449758-78449780 GTGTGGTGTCCTTATCAGCAAGG + Intergenic
1057018522 9:91677285-91677307 TTATAGATTCCTTATCAGCAAGG - Intronic
1059208833 9:112492073-112492095 GTGTGAATTCTTAACCAGCTAGG + Intronic
1060092725 9:120758386-120758408 ATCTGGATTCCTTAACATCATGG - Exonic
1185768217 X:2743621-2743643 GTGTCGAATCCTCAACAGCAGGG + Intergenic
1198326315 X:135577302-135577324 TTGTGGTTTCCTCAACAGCAGGG - Exonic
1200033180 X:153312525-153312547 GGGTGGATTTCTCTCCAGCAAGG - Intergenic