ID: 1050343323

View in Genome Browser
Species Human (GRCh38)
Location 9:4662507-4662529
Sequence CAGCAGCCGCGCCACGGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050343317_1050343323 25 Left 1050343317 9:4662459-4662481 CCATGGCGGCGGTGGCGGCGGCA 0: 1
1: 2
2: 31
3: 244
4: 531
Right 1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG 0: 1
1: 0
2: 1
3: 24
4: 178
1050343316_1050343323 26 Left 1050343316 9:4662458-4662480 CCCATGGCGGCGGTGGCGGCGGC 0: 1
1: 2
2: 26
3: 189
4: 485
Right 1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG 0: 1
1: 0
2: 1
3: 24
4: 178
1050343313_1050343323 30 Left 1050343313 9:4662454-4662476 CCAGCCCATGGCGGCGGTGGCGG 0: 1
1: 0
2: 2
3: 28
4: 223
Right 1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG 0: 1
1: 0
2: 1
3: 24
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050343323 Original CRISPR CAGCAGCCGCGCCACGGCCG TGG Exonic