ID: 1050345319

View in Genome Browser
Species Human (GRCh38)
Location 9:4680004-4680026
Sequence GTCCCCGGCCCCTGGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 372}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050345319_1050345336 30 Left 1050345319 9:4680004-4680026 CCTCACTGCCAGGGGCCGGGGAC 0: 1
1: 0
2: 4
3: 58
4: 372
Right 1050345336 9:4680057-4680079 CCTTTTATGGCATCTTCGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1050345319_1050345331 26 Left 1050345319 9:4680004-4680026 CCTCACTGCCAGGGGCCGGGGAC 0: 1
1: 0
2: 4
3: 58
4: 372
Right 1050345331 9:4680053-4680075 CACCCCTTTTATGGCATCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 102
1050345319_1050345327 17 Left 1050345319 9:4680004-4680026 CCTCACTGCCAGGGGCCGGGGAC 0: 1
1: 0
2: 4
3: 58
4: 372
Right 1050345327 9:4680044-4680066 ATGCCATCCCACCCCTTTTATGG 0: 1
1: 0
2: 0
3: 8
4: 101
1050345319_1050345334 29 Left 1050345319 9:4680004-4680026 CCTCACTGCCAGGGGCCGGGGAC 0: 1
1: 0
2: 4
3: 58
4: 372
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050345319 Original CRISPR GTCCCCGGCCCCTGGCAGTG AGG (reversed) Intronic
900134081 1:1106880-1106902 ACCCCCGGCCCTGGGCAGTGAGG + Intronic
900185062 1:1329010-1329032 GCCCCCTGAGCCTGGCAGTGGGG - Intergenic
900212165 1:1461544-1461566 ACCCCCAGACCCTGGCAGTGAGG + Intronic
900371270 1:2333242-2333264 GTCCCCGGCCTGTTGCAGCGGGG - Intronic
901045629 1:6393853-6393875 GGCCCGGGCTCCTGGCAGTGGGG + Intronic
901045983 1:6395984-6396006 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
901172277 1:7267830-7267852 TTCCCCTGCCCCTCTCAGTGAGG + Intronic
902032122 1:13430663-13430685 GCCACCGGCCCCAGGCAGTGAGG + Intergenic
902148160 1:14420756-14420778 GCCGCCGGCCCCGGGCAGTGAGG - Intergenic
902255196 1:15184367-15184389 GTCCCTGGCCACTCACAGTGTGG - Intronic
902378540 1:16041798-16041820 CTCCTAGGCACCTGGCAGTGGGG + Intergenic
903366938 1:22810966-22810988 GTTCCCTGCCCCTTGGAGTGAGG + Intronic
905336017 1:37245045-37245067 GCCCCCGATCCCTGGCAGTCAGG + Intergenic
905761154 1:40559124-40559146 GCCGCTGGCCCCAGGCAGTGCGG - Intergenic
906877720 1:49556955-49556977 ACCGCCGGCCCCAGGCAGTGAGG - Intronic
907102244 1:51847631-51847653 GCCGCTGGCCCCTGGCAGTGAGG - Intronic
907407722 1:54263807-54263829 GCCCCTTGCCCATGGCAGTGTGG - Intronic
907662831 1:56409139-56409161 CTCCCCAGCCCCATGCAGTGCGG + Intergenic
907759504 1:57343660-57343682 CCCACCGGCCCCAGGCAGTGAGG - Intronic
908842525 1:68294137-68294159 ATCCCCGGCCACTGACTGTGAGG + Intergenic
910550282 1:88467173-88467195 CGGCCCGGCCCCGGGCAGTGAGG + Intergenic
915322509 1:155063551-155063573 CTTCCCGCCCCCTCGCAGTGCGG + Intergenic
916721471 1:167487474-167487496 GTACCTGCTCCCTGGCAGTGTGG - Intronic
918542711 1:185649181-185649203 GCCACCGGCCCTGGGCAGTGAGG - Intergenic
918793167 1:188857766-188857788 GCCACCGCCCCCAGGCAGTGCGG + Intergenic
918857680 1:189779886-189779908 TGCCTCTGCCCCTGGCAGTGTGG - Intergenic
919630944 1:199959767-199959789 GCCGTCGGCCCCGGGCAGTGAGG + Intergenic
919796789 1:201325657-201325679 GTGTCCAGGCCCTGGCAGTGGGG + Intronic
920070021 1:203296119-203296141 ATCCTGGGCCCCTGGGAGTGAGG + Intergenic
920218417 1:204377808-204377830 CTCCCGGGTCCCTGGCAGTGTGG + Intergenic
921070997 1:211657197-211657219 GGCCCCAGCCCATGGCAGTTTGG - Intergenic
922416672 1:225428237-225428259 CTCCCCGCCCCCAGGCAGGGTGG - Intronic
922886466 1:229024586-229024608 GCCCGAGGCCCCTGGCAGTGCGG - Intergenic
923102013 1:230824296-230824318 GTCCCATGCCCCTGGGAGGGTGG + Intergenic
923512414 1:234663970-234663992 GTCCCTCGCCCCTTGGAGTGAGG - Intergenic
923533125 1:234827414-234827436 CTCCTAGACCCCTGGCAGTGGGG - Intergenic
924052640 1:240093119-240093141 GTCCCCAGCCCCTCGCACGGGGG - Exonic
1062954312 10:1530086-1530108 GTCCACTGCCCCTGCCAATGCGG + Intronic
1063573003 10:7233841-7233863 GTCCCATGGCCCTGGCAGGGAGG + Intronic
1065131297 10:22622632-22622654 GTGCCCGTCCACTGACAGTGGGG - Intronic
1065284802 10:24176978-24177000 ACCACCGGCCCCGGGCAGTGAGG - Intronic
1066598205 10:37076114-37076136 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1066615070 10:37285420-37285442 GCCACCGGCCCCAGGCAGTGAGG - Intronic
1067015634 10:42754954-42754976 GTCCCAGGCCCCAGGCAGCCCGG + Intergenic
1067047098 10:42990980-42991002 GTCTCCAGCCCGTGTCAGTGGGG + Intergenic
1067560375 10:47300773-47300795 GTCGGCGGCCGCGGGCAGTGCGG - Exonic
1068216662 10:53990918-53990940 GCCACCGGCCCTGGGCAGTGAGG + Intronic
1069419262 10:68231676-68231698 ATCCCCGGCCCCAAGCAGCGAGG + Exonic
1069705229 10:70455336-70455358 GCCCCCAGCCCCTGCCTGTGTGG - Intergenic
1069709273 10:70478680-70478702 GCCCCCCGCCCCTCGCGGTGGGG + Intergenic
1070148087 10:73789105-73789127 GTGCCTGGCCAATGGCAGTGCGG + Exonic
1070172714 10:73944709-73944731 GCCACCGGCCCTGGGCAGTGAGG + Intergenic
1070325807 10:75388142-75388164 GTGGCCGCCCCCTGCCAGTGAGG - Intergenic
1070391702 10:75976556-75976578 GCCCCCTGCACCTGGCAGAGGGG + Intronic
1071078710 10:81784324-81784346 GCCACCAGCCCCGGGCAGTGAGG + Intergenic
1072341860 10:94459751-94459773 GCCACTGGCCCCGGGCAGTGAGG - Intronic
1072607912 10:96999419-96999441 GTCCCCTGCCCAGGGCAGTGAGG - Exonic
1072638802 10:97195730-97195752 ATCCCCTGTCCCTGTCAGTGGGG - Intronic
1073262500 10:102201122-102201144 GCCGCCGGCCCCAGGCAGTGAGG - Intergenic
1074098124 10:110331564-110331586 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1074314579 10:112349839-112349861 GCCGCCAGCCCCGGGCAGTGAGG + Intergenic
1074996353 10:118760401-118760423 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1075098938 10:119492476-119492498 GGCCCCGGCCCCAGCCAGGGAGG - Intergenic
1075793279 10:125101235-125101257 GTTCCCGGCCTCTCCCAGTGTGG + Intronic
1075799866 10:125146918-125146940 GACCCCAGGCCCTGGCAATGGGG - Intronic
1076700724 10:132271307-132271329 TTCCCAGGCCCCTGGCACTCAGG + Intronic
1076732917 10:132447203-132447225 GAGCCCGGCCCCTGGTAGAGGGG + Intronic
1076756589 10:132575776-132575798 GGCCCAGGGCCCTGGCAGTGGGG + Intronic
1076943322 10:133625183-133625205 TTCCCCAGGACCTGGCAGTGTGG + Exonic
1077124133 11:925081-925103 GCCCCCGGCCGCTGTCACTGGGG + Intronic
1077344296 11:2039254-2039276 GTCCCCAGCCCCTGGCTCTCGGG - Intergenic
1077402582 11:2366510-2366532 GTCCCCAGCCACTGCCAGTGAGG + Intergenic
1080600372 11:33816515-33816537 GTCTCAGGCCCCAGGCAGTGTGG - Intergenic
1081713191 11:45231144-45231166 TTCCCTGTCCCATGGCAGTGTGG - Intronic
1081773573 11:45664031-45664053 TTCCTCAGCCCCTTGCAGTGGGG - Intronic
1082243213 11:49892166-49892188 GCCCCAGGACCCTGGCAGCGGGG + Intergenic
1082987668 11:59182216-59182238 GGCCCCAGAGCCTGGCAGTGGGG - Exonic
1084021652 11:66421381-66421403 GTCTCCGGCGCCTGGCAGCTCGG - Intronic
1084430126 11:69106411-69106433 GTCCATGACCACTGGCAGTGGGG + Intergenic
1085351045 11:75798028-75798050 CTCCCCAGTCCCTAGCAGTGGGG + Intronic
1085450531 11:76629555-76629577 GTCCCCAGCCCCAGGCAGAGGGG + Intergenic
1085863119 11:80257669-80257691 CCCGCCAGCCCCTGGCAGTGAGG + Intergenic
1086001097 11:81986929-81986951 GCCACTGGCCCCGGGCAGTGAGG - Intergenic
1086697641 11:89863989-89864011 GCCCCAGGACCCTGGCAGCGGGG + Intergenic
1086708518 11:89980499-89980521 GCCCCAGGACCCTGGCAGCGGGG - Intergenic
1087401000 11:97667190-97667212 GCCACCAGCCCCGGGCAGTGAGG + Intergenic
1087683814 11:101241503-101241525 GCCACTGGCCCCAGGCAGTGAGG - Intergenic
1088521978 11:110711335-110711357 GTCCCTGGCCCCTGGGACTCTGG - Intronic
1088869061 11:113875802-113875824 GTTCCCGGACACTGGCAGCGCGG - Intergenic
1088911059 11:114192913-114192935 CTCCCCTGCCCCTGGCTGAGAGG - Intronic
1089244747 11:117110706-117110728 GCCTCCCGCCCCGGGCAGTGAGG - Intergenic
1089658444 11:119969663-119969685 TGCCCTGGCCCCTGGCATTGAGG + Intergenic
1090133558 11:124170932-124170954 CCCACCGGCCCCCGGCAGTGAGG - Intergenic
1202827282 11_KI270721v1_random:94443-94465 GTCCCCAGCCCCTGGCTCTCGGG - Intergenic
1092045539 12:5430045-5430067 CTCCCAGGTCCCTGGCAGTCTGG - Intergenic
1095533970 12:43224429-43224451 CCCACCGGCCCCGGGCAGTGAGG + Intergenic
1096111572 12:49031962-49031984 GTCCCAGGCTCCTGGTAGGGTGG + Exonic
1096876022 12:54631133-54631155 GTCCCCTGCCCCTGCCAAGGTGG - Intronic
1097174396 12:57134387-57134409 GTTCTCTGGCCCTGGCAGTGGGG - Intronic
1097247268 12:57613460-57613482 GTCCCAAGCCCCTGAGAGTGAGG + Exonic
1097262645 12:57728169-57728191 ATCCCGAGCCCCTGGGAGTGGGG + Intronic
1097264563 12:57737946-57737968 GTCCCCGGCTCCGGCCAGTCCGG - Exonic
1098498770 12:71166462-71166484 CCCGCCGGCCCCTGGCAGTGAGG - Intronic
1099190949 12:79561646-79561668 GCCACCGGTCCCAGGCAGTGAGG + Intergenic
1102387243 12:112520143-112520165 CCCACCGGCCCCGGGCAGTGAGG - Intergenic
1103433415 12:120906268-120906290 GGTCCTGGCACCTGGCAGTGGGG - Intergenic
1103760889 12:123249573-123249595 GCCGCCGGCCCCAGGCAGTGAGG - Intronic
1104198742 12:126567145-126567167 GCAGCCGGCCCCAGGCAGTGAGG + Intergenic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1104917667 12:132274269-132274291 GCGCCCGGCCCCTGGCTCTGTGG + Intronic
1105605166 13:21920919-21920941 CCCGCCGGCCCCAGGCAGTGAGG - Intergenic
1105701550 13:22938891-22938913 GCCGCCGGCCCCAGGCAGTAAGG - Intergenic
1106294179 13:28395001-28395023 GTGCATGGCCCCTTGCAGTGTGG + Intronic
1107662915 13:42658134-42658156 CTCCACGGCCCCAGGCAGGGTGG - Intergenic
1108323252 13:49306312-49306334 GTCCCCTGCAGCTGGCACTGGGG - Intergenic
1108845658 13:54676677-54676699 GCCACTGGCCCCAGGCAGTGAGG + Intergenic
1108991154 13:56659367-56659389 GCCACCGGCCCCAGGCAGTGAGG - Intergenic
1109111026 13:58318790-58318812 ACCGCCGGCCCCAGGCAGTGAGG - Intergenic
1109563165 13:64077748-64077770 CCCACCGGCCCCGGGCAGTGAGG - Intergenic
1109638102 13:65149827-65149849 GCCGCCGGCCCCAGGCAGTGAGG - Intergenic
1109884368 13:68524049-68524071 GCTGCCGGCCCCAGGCAGTGAGG + Intergenic
1111220896 13:85205019-85205041 GCCGCTGGCCCCGGGCAGTGAGG + Intergenic
1112282696 13:98076546-98076568 CCCGCCGGCCCCAGGCAGTGAGG - Intergenic
1112566340 13:100553882-100553904 GTACCTGGCCCCTGGCACAGAGG - Intronic
1113474366 13:110569750-110569772 GACTCCAGCCCTTGGCAGTGTGG - Intergenic
1115110143 14:29811610-29811632 ATCCTCAGCCCCTGGCAGAGAGG - Intronic
1115284242 14:31700652-31700674 GCCACTGGCCCCGGGCAGTGAGG + Intronic
1116223190 14:42113703-42113725 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1116311002 14:43326711-43326733 GCCACCGGCCCTGGGCAGTGAGG + Intergenic
1117545823 14:56794441-56794463 GACCGCGGCCCCAGGCAGGGTGG - Intergenic
1118089545 14:62458064-62458086 CTCCCTGGGGCCTGGCAGTGTGG + Intergenic
1118306323 14:64658273-64658295 GCCGCCGGCCCGGGGCAGTGAGG + Intergenic
1119113278 14:71995398-71995420 GAGCCTGGCCCCTGGCAGGGTGG + Intronic
1120215747 14:81679444-81679466 GCCCCCGGCCGCTCGGAGTGTGG + Intergenic
1121588220 14:95078642-95078664 GTCCCTGGTGCCGGGCAGTGTGG - Intergenic
1122894832 14:104751752-104751774 GCCACCGGCCCCAGGCAGTGAGG - Intergenic
1123038644 14:105481512-105481534 GTCCCCAACCCCAGGCAGAGGGG + Intergenic
1124061599 15:26298316-26298338 ACCGCCGGCCCCGGGCAGTGAGG - Intergenic
1125506130 15:40268667-40268689 GTACCTAGCCCCAGGCAGTGAGG + Intronic
1126997572 15:54462561-54462583 GCCCCCGGCCCCGGGGAGTGAGG + Intronic
1127858325 15:62971429-62971451 GTTCCCGGGACCTGGCAGAGAGG + Intergenic
1127922439 15:63504321-63504343 TTCCCCGGCCCCGGGAAGGGTGG - Intergenic
1128374696 15:67066397-67066419 GGCCCAGCCCCCTGGCACTGCGG + Intronic
1128806655 15:70536143-70536165 TTCCCCGTCCGCTGGCTGTGTGG - Intergenic
1129038542 15:72665426-72665448 GGCCCCAGCCCCAGGGAGTGGGG + Intronic
1129211348 15:74071804-74071826 GGCCCCAGCCCCAGGGAGTGGGG - Intronic
1129712982 15:77830567-77830589 CTCCCCGGCCCAGGGCAGTGGGG + Intergenic
1130754875 15:86752603-86752625 GCCTCTGGCCCCTGGCAATGGGG - Intronic
1131012711 15:89031911-89031933 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1131912583 15:97224354-97224376 GACACTGGCCCCAGGCAGTGAGG + Intergenic
1131969420 15:97876684-97876706 AGCCACGGCCCCTTGCAGTGAGG - Intergenic
1132044210 15:98549860-98549882 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1132097703 15:99000156-99000178 CCCGCCGGCCCCAGGCAGTGAGG + Intronic
1132155844 15:99494888-99494910 GCCCCCGGCCCCGGGCAGTGAGG - Intergenic
1132574961 16:660046-660068 GTCCCTGGCGCCTGGCAGGGAGG - Exonic
1132612450 16:824131-824153 GTCCCCGGCACTCGGCTGTGAGG - Intergenic
1133051461 16:3119545-3119567 GGGCCTGGCCCCTGACAGTGAGG + Exonic
1133826684 16:9284225-9284247 GAAGCTGGCCCCTGGCAGTGGGG - Intergenic
1135040925 16:19115858-19115880 GTCCCCTGCCCAAGGCACTGAGG + Exonic
1136004436 16:27318952-27318974 GTCCCCAGCCCCTGGCACTTTGG - Intronic
1136072766 16:27798280-27798302 CTCCCCAGCTCCTGGCAGAGGGG - Intronic
1137534826 16:49312191-49312213 GTCCCCAGCCCCTGGCTGGCTGG + Intergenic
1137719288 16:50618547-50618569 GGCGCCTGCCCCTGGCATTGGGG + Intronic
1138252077 16:55509216-55509238 GACGCCGGCACCTGGCACTGTGG - Exonic
1138688766 16:58748961-58748983 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
1139377694 16:66510576-66510598 CTCCCAGGCCCCTGTGAGTGTGG - Exonic
1139442302 16:66974377-66974399 CTGGCCGGCCCCAGGCAGTGAGG + Exonic
1139514405 16:67444893-67444915 GTCCTAGGCCTCTGGCAGTGGGG - Intronic
1141900819 16:86989110-86989132 TCCCCCGGCCCCCGGCACTGGGG + Intergenic
1142264675 16:89058276-89058298 GTCACCCCCGCCTGGCAGTGGGG - Intergenic
1142398964 16:89849246-89849268 GGCCCCCCACCCTGGCAGTGTGG + Intronic
1142496682 17:309768-309790 ATCCCGGACCCCTGGCAGGGGGG - Intronic
1143283351 17:5771351-5771373 GCCGCCAGCCCCCGGCAGTGAGG + Intergenic
1145066767 17:19766636-19766658 GCGCCCGCCCCCAGGCAGTGAGG - Intergenic
1147044873 17:37744725-37744747 GCCCCTGTCCCCTGGCAGCGGGG - Exonic
1147212162 17:38877968-38877990 GTCCTAGGCCCATGGCTGTGGGG - Intronic
1147451698 17:40509788-40509810 CTCCCTGGACCCTGACAGTGTGG + Intergenic
1147609769 17:41794569-41794591 CTCCCTGGCCCCAGGCAGTAGGG - Intergenic
1147805331 17:43126927-43126949 ACCCCCGGCCCCGGGCAGTCAGG + Intergenic
1147988148 17:44318262-44318284 GTCCATGGCCCCTGGCAGGTGGG - Exonic
1150010040 17:61494845-61494867 GCCCCAAACCCCTGGCAGTGGGG - Intergenic
1150326531 17:64262865-64262887 GTCCCCGGCCCCGGGCAGGGAGG - Intronic
1152732115 17:81977555-81977577 GGCCCCGCCCCCTGGCCGCGTGG + Exonic
1152793000 17:82292439-82292461 GTCCCCCGTCCCGGGCGGTGAGG + Intergenic
1153868697 18:9297043-9297065 GCCACTGGCCCCAGGCAGTGAGG + Intergenic
1154255324 18:12777108-12777130 GCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1155806313 18:30175371-30175393 GCCACCGGCCCGCGGCAGTGAGG - Intergenic
1156243054 18:35271900-35271922 GCCGCCGGCCCCAGGCAGTAAGG - Intronic
1156463148 18:37332854-37332876 GCCCTCTGCCCTTGGCAGTGAGG - Intronic
1156629065 18:38944656-38944678 GTCGCCGGCACTGGGCAGTGAGG - Intergenic
1156657815 18:39309200-39309222 GCTGCCGGCCCCAGGCAGTGAGG + Intergenic
1156969663 18:43139628-43139650 CCCCCCAGCCCCGGGCAGTGAGG + Intergenic
1157597128 18:48870779-48870801 TTCGCCTGCCCCTGGGAGTGGGG + Intergenic
1157614597 18:48978998-48979020 TTCGCCTGCCCCTGGGAGTGGGG - Intergenic
1158266428 18:55664997-55665019 CCCGCCGGCCCCTGGCAGTGAGG + Intergenic
1158760463 18:60379838-60379860 GTCCTGGGCCCCTGGCACTCTGG - Intergenic
1159743947 18:72209231-72209253 CCCGCCGGCCCCAGGCAGTGAGG + Intergenic
1160673094 19:375599-375621 GGGCTCAGCCCCTGGCAGTGGGG - Intronic
1160716679 19:579916-579938 GTGCCCGGGACCTGGCAGTGTGG - Intronic
1161031108 19:2058126-2058148 CTCCCAGGGCCCTGGCAGAGTGG + Intergenic
1161342624 19:3751407-3751429 GGCCCCGGCCCCTGGCCCCGGGG - Intronic
1161540397 19:4847495-4847517 GTGCCCGGCCCCAGACAGTGTGG + Intronic
1162675463 19:12295003-12295025 AGACCCGGCCCCTGGCAGGGCGG + Intergenic
1163571803 19:18086733-18086755 GTCCCCTGACCCTGGCATGGCGG - Intronic
1163699895 19:18781815-18781837 GTCCCTGGCTCCTGGGGGTGGGG - Exonic
1165415535 19:35691312-35691334 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1166075455 19:40411503-40411525 GTCCCAGGCCCGTGGCTGTGAGG + Intronic
1166963940 19:46516443-46516465 CTCCCCGGGCAGTGGCAGTGGGG - Intronic
1168585473 19:57588212-57588234 GACCCAGGCCCCTGGCATTGAGG + Intronic
1168599841 19:57708835-57708857 GTCCCCGACCCTGGGCAGCGGGG + Intronic
925003220 2:422660-422682 TTCCCCAGCCCCTCGCTGTGAGG - Intergenic
925172610 2:1759550-1759572 ACCGCCGGCCCCGGGCAGTGAGG - Intergenic
925443805 2:3910377-3910399 GTCCCCTGCCCCTGCCACAGGGG - Intergenic
927357074 2:22186449-22186471 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
927942193 2:27111721-27111743 CCCGCCGGCCCCGGGCAGTGAGG - Intronic
928599203 2:32886821-32886843 GCCGCTGGCCCCAGGCAGTGAGG - Intergenic
931218705 2:60269802-60269824 GCCCCTGTCCCTTGGCAGTGTGG - Intergenic
931772143 2:65506728-65506750 GTCCCAGGACCCTGGCAGCCCGG - Intergenic
932675798 2:73779932-73779954 GTCTCCGGCCCCAGCCACTGCGG + Exonic
935603670 2:104948038-104948060 GTTCCCGGGCTCTGGCAGAGTGG - Intergenic
937224388 2:120359913-120359935 GTGCCAGGCCCTGGGCAGTGAGG - Intergenic
937789442 2:125943178-125943200 GCTGCCGGCCCCAGGCAGTGAGG - Intergenic
937877699 2:126837671-126837693 GTGCCAGGCCCATGGCAGGGTGG + Intergenic
940361946 2:152805074-152805096 GCCGCCGGCCCCAGGCAGTGAGG - Intergenic
942170268 2:173282842-173282864 GCTGCCGGCCCCGGGCAGTGAGG - Intergenic
942299601 2:174548805-174548827 GGCTGCGGCCCCGGGCAGTGAGG - Intergenic
942620012 2:177835780-177835802 GCCGCCGGCCCTGGGCAGTGAGG + Intronic
943443278 2:187951821-187951843 GCTACCGGCCCCTGGCAGTGAGG + Intergenic
943790034 2:191921737-191921759 GCCCGCTGCCCCAGGCAGTGAGG + Intergenic
945649453 2:212539470-212539492 GTCCCAGGCCTCTGCCAGGGAGG - Intergenic
945869137 2:215207980-215208002 GCCGCCGGCCCCGGGCAGTGAGG + Intergenic
945907905 2:215615139-215615161 GCCGCCGGCCCCGGGCAGTGAGG - Intergenic
946376500 2:219312927-219312949 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
946929130 2:224655405-224655427 GCCGCTGGCCCCAGGCAGTGAGG + Intergenic
948795293 2:240399496-240399518 TTCCCAGGCCCCTGGCCCTGAGG + Intergenic
1168968284 20:1913384-1913406 CTGCCCTGCCCCTGCCAGTGGGG + Intronic
1169120922 20:3095126-3095148 GTCCCCGGCCCCAGGCTGGAAGG + Intergenic
1171973441 20:31578816-31578838 GCCCGCCGCCCCAGGCAGTGAGG - Intergenic
1172768011 20:37361397-37361419 GTGGCCTGCCCCTGGCTGTGTGG - Intronic
1174982201 20:55408660-55408682 CTCCCCAACCCCTGGCAGTGTGG - Intergenic
1175970915 20:62686432-62686454 GTCCCCGGCCCTTGGTGGAGCGG - Intergenic
1175976516 20:62712982-62713004 GTCCCAGGCCCCTGCCACTGTGG - Intronic
1176053157 20:63131151-63131173 GGCCCCTGCCCCTTGCTGTGTGG - Intergenic
1176242063 20:64079810-64079832 GTCCCCGGGCCCGGGCCGGGAGG + Intronic
1176332298 21:5559860-5559882 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
1176395459 21:6261091-6261113 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1176415365 21:6471599-6471621 TTCCCAGGCCCCTGGCAGCACGG + Intergenic
1176441698 21:6728013-6728035 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
1176465960 21:7055082-7055104 CCCACCGGCCCCAGGCAGTGAGG - Intronic
1176489521 21:7436860-7436882 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
1179495266 21:41767166-41767188 GTCACCGGGCGCTGGCAGAGAGG - Intergenic
1179690865 21:43079932-43079954 TTCCCAGGCCCCTGGCAGCACGG + Intergenic
1180962033 22:19766491-19766513 GCCGCCGGCCCCGGGCAGCGAGG - Exonic
1183413845 22:37671572-37671594 GCCCCCTGTCCCTGGCAGGGCGG + Intergenic
1183662572 22:39230264-39230286 TTCCCGGGCTCCTGGCTGTGTGG - Intronic
1183961586 22:41414554-41414576 GTGGCAGGCCCCTGGCAGGGAGG - Intergenic
1184069337 22:42138389-42138411 GCCTCTGGCCCCAGGCAGTGAGG + Intergenic
1184643806 22:45885568-45885590 GTCCCCGTCCCTGGGGAGTGGGG - Intergenic
1185094223 22:48797427-48797449 GTTCCCGAGCCCTGGCACTGAGG + Intronic
950207881 3:11094143-11094165 CCCGCCGGCCCCAGGCAGTGAGG + Intergenic
950580857 3:13861240-13861262 ATCCTCCACCCCTGGCAGTGGGG + Intronic
951323214 3:21271875-21271897 GCCACTGGCCCCGGGCAGTGAGG - Intergenic
951551891 3:23882789-23882811 GCCACTGGCCCCAGGCAGTGAGG - Intronic
952713311 3:36453452-36453474 CCCACCGGCCCCGGGCAGTGAGG + Intronic
952845925 3:37688122-37688144 CTTCCTGGCCCCAGGCAGTGTGG - Intronic
953096264 3:39779852-39779874 GTGGCTGGGCCCTGGCAGTGAGG + Intergenic
953423020 3:42769817-42769839 GCCGCAAGCCCCTGGCAGTGAGG + Intronic
953861701 3:46549797-46549819 GGCCCACGCCCTTGGCAGTGGGG - Intronic
954226204 3:49182876-49182898 CCCCCCCGCCCCGGGCAGTGAGG - Intronic
954230574 3:49213694-49213716 GCCGCTGGCCCCAGGCAGTGAGG - Intronic
954289777 3:49643505-49643527 GTCACAGGTCCATGGCAGTGTGG - Intronic
956459211 3:69454544-69454566 GCCACCGGCCCCGGGCAGTGAGG + Intronic
959308233 3:104696570-104696592 GTGCCCTGCCCCTGGAGGTGGGG + Intergenic
960199411 3:114812907-114812929 CCCACCGGCCCCGGGCAGTGAGG - Intronic
960560051 3:119073655-119073677 GCTCCCGGCCCTGGGCAGTGAGG - Intronic
961461969 3:127056361-127056383 CTCGCCAGCCCCGGGCAGTGAGG - Intergenic
961646795 3:128397092-128397114 CTCCCAGGCCCAGGGCAGTGGGG - Intronic
961751286 3:129096247-129096269 GGCCTCTGCCCCTGGCACTGTGG + Intronic
962177253 3:133167645-133167667 GGCACTGGCCCCGGGCAGTGAGG - Intronic
962977107 3:140455512-140455534 GTCCCTGGGCCCTAGCAGGGTGG - Intronic
964265388 3:154889493-154889515 GCCGCCGGCCTCGGGCAGTGAGG - Intergenic
964381092 3:156099574-156099596 CCCACCGGCCCCAGGCAGTGAGG + Intronic
964982514 3:162703178-162703200 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
965256777 3:166424083-166424105 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
965728565 3:171745992-171746014 GCCACCGGCCCCGGGCAGTGAGG + Intronic
966108219 3:176362476-176362498 GGCGCGGGCCCCGGGCAGTGAGG - Intergenic
966219450 3:177535999-177536021 TTCCCTGGCTGCTGGCAGTGAGG + Intergenic
966933719 3:184691969-184691991 GTGCAGGGCCCCTGGCAGTCAGG + Intergenic
967594931 3:191317251-191317273 GCCCCCGGCCCCAGGCAGTGAGG - Intronic
968942600 4:3646570-3646592 GTCGCCAGCTCCTGGGAGTGAGG - Intergenic
970272116 4:14358770-14358792 CTTGCCGGCCCCGGGCAGTGAGG + Intergenic
971209140 4:24599369-24599391 GTCGCTGGCCCCGGGCAGTGAGG - Intergenic
971792366 4:31185219-31185241 GCCGCCGGCCCCAGGCAGTGAGG - Intergenic
973854104 4:54993620-54993642 GCCCACTGCCCCAGGCAGTGAGG + Intergenic
974263343 4:59553476-59553498 GTCACCAGCCTCTGGCAGTTGGG + Intergenic
974299261 4:60042471-60042493 GCCGCCGGCCCAGGGCAGTGAGG - Intergenic
974839352 4:67283073-67283095 GCCACTGGCCCCGGGCAGTGAGG - Intergenic
975298810 4:72766006-72766028 CCCACCCGCCCCTGGCAGTGAGG + Intergenic
976846066 4:89490164-89490186 CCCGCCGGCCCCCGGCAGTGAGG + Intergenic
977641157 4:99359791-99359813 ACCACCGGCCCCAGGCAGTGAGG + Intergenic
978254895 4:106681708-106681730 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
978748556 4:112222540-112222562 GCTGCCGGCCCCAGGCAGTGAGG + Intergenic
978809075 4:112830914-112830936 GCCACCAGCCCCAGGCAGTGAGG + Intronic
980384039 4:132063014-132063036 GCCGCTGGCCCCAGGCAGTGAGG - Intergenic
980595445 4:134948404-134948426 ATCACCGGCCCAGGGCAGTGAGG - Intergenic
983834254 4:172369723-172369745 ACCACCGGCCCCGGGCAGTGAGG - Intronic
983843192 4:172482125-172482147 GCCACCGGCCCTGGGCAGTGAGG - Intronic
984805355 4:183746694-183746716 GATGCCGGCCCCGGGCAGTGAGG - Intergenic
984901742 4:184592016-184592038 CCCACCGGCCCCGGGCAGTGAGG + Intergenic
984918091 4:184741314-184741336 GACACCAGCCCCGGGCAGTGAGG + Intergenic
985269288 4:188179069-188179091 GCCGCCCGCCCCGGGCAGTGAGG + Intergenic
985446678 4:190025645-190025667 TTCCCCAGGACCTGGCAGTGTGG + Exonic
985470601 5:41731-41753 GACCACTGCCCCTGGCACTGGGG - Intergenic
985761629 5:1752000-1752022 GACCCCAGCCCAGGGCAGTGGGG + Intergenic
985775164 5:1837599-1837621 GTCACCAGGCCCGGGCAGTGGGG - Intergenic
986963582 5:13244296-13244318 GCCACCAGCCCCAGGCAGTGAGG + Intergenic
987347438 5:16991191-16991213 CTCGCCAGCCCCGGGCAGTGAGG - Intergenic
987352288 5:17032645-17032667 CCCGCCGGCCCCTGGAAGTGAGG - Intergenic
988442676 5:31250272-31250294 GTGCATGGCCCCTAGCAGTGGGG + Intronic
988500122 5:31777210-31777232 GCCACTGGCCCCGGGCAGTGAGG + Intronic
988577932 5:32444560-32444582 CTCCCTGGCCCCGGGCAGCGGGG - Intronic
992050352 5:72935346-72935368 GCTGCCGGCCCCGGGCAGTGAGG + Intergenic
992665552 5:79005236-79005258 TGCCACAGCCCCTGGCAGTGAGG + Intronic
995533227 5:113111275-113111297 GTCCCCTCCCCATGGCTGTGTGG + Intronic
995913320 5:117213865-117213887 GTCCCCTGGCCCTGACAGTTAGG - Intergenic
995988450 5:118208214-118208236 GCCCCCGGCCAGGGGCAGTGAGG - Intergenic
997233411 5:132259050-132259072 GCCCCAGGGACCTGGCAGTGAGG - Intronic
998797505 5:145835439-145835461 GGCCCCGGACTCTGGCAGTAGGG - Intergenic
999204220 5:149836648-149836670 GGCACAGGCCCCTGGCAGGGAGG + Exonic
999809569 5:155114939-155114961 GCCCCCGGCTCTGGGCAGTGAGG + Intergenic
1000609137 5:163355965-163355987 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
1001565939 5:172699577-172699599 GGCCCTGGCCCCTGGCAATGAGG - Intergenic
1001841534 5:174880776-174880798 GCCGCCGGCCCCGGGCAGTGAGG + Intergenic
1002062002 5:176630575-176630597 CTCCCCGCCCCCTGTCAGTCAGG - Intergenic
1002277478 5:178113471-178113493 GGCCCCGGCCCCCGGATGTGGGG - Exonic
1002321092 5:178376456-178376478 CTCCCCAGCACCAGGCAGTGGGG - Intronic
1002321245 5:178377383-178377405 GGCCCCGGCCCCTGGAGATGAGG - Intronic
1002616438 5:180459277-180459299 GCCACCGGCCCCGGGCAGTGAGG + Intergenic
1002793197 6:450089-450111 GTGGCCGGCCCCAGGCAGTGAGG + Intergenic
1002959775 6:1904109-1904131 GTCCCGTGCCCCTGGAAGTCTGG - Intronic
1003516668 6:6824101-6824123 GTCCCTTGCTCCTGGCACTGGGG + Intergenic
1003589600 6:7425890-7425912 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
1003749573 6:9040867-9040889 CTCGACGGCCCCGGGCAGTGAGG + Intergenic
1003881413 6:10482973-10482995 GCTGCCGGCCCCAGGCAGTGAGG - Intergenic
1004354060 6:14916091-14916113 GCCGCCGGCCCCAGGCAGTGAGG + Intergenic
1004861386 6:19807220-19807242 GGTGCCGGCCCCGGGCAGTGAGG - Intergenic
1004906207 6:20239171-20239193 CCCGCCGGCCCCGGGCAGTGAGG + Intergenic
1005117741 6:22356659-22356681 CCCGCCAGCCCCTGGCAGTGAGG - Intergenic
1005312959 6:24576388-24576410 GTCCCTGGGTCCTGGGAGTGAGG - Exonic
1005561435 6:27045393-27045415 CCCGCCGGCCCCAGGCAGTGAGG + Intergenic
1005725065 6:28639994-28640016 CCCACCGGCCCCGGGCAGTGAGG - Intergenic
1005825666 6:29630448-29630470 TTCCCCTCACCCTGGCAGTGGGG + Exonic
1006434140 6:34017434-34017456 GCCGCCAGCCCCAGGCAGTGAGG - Intergenic
1007365206 6:41386587-41386609 GTCCAAGGCCCCTGGCAGACAGG - Intergenic
1008567827 6:52786623-52786645 CCCGCCGGCCCCAGGCAGTGAGG + Intergenic
1009739268 6:67723161-67723183 ACCACCGGCCCCAGGCAGTGAGG + Intergenic
1010489232 6:76453508-76453530 TTCCCGGGCCCCAGGGAGTGCGG + Intergenic
1011811402 6:91136203-91136225 GTCCCCGGCTCCTGGCATAGTGG - Intergenic
1011931795 6:92723609-92723631 GCCGCCAGCCCCGGGCAGTGAGG + Intergenic
1012145011 6:95670149-95670171 GCCCCCAGCCCTGGGCAGTGAGG + Intergenic
1012598849 6:101070371-101070393 GCCACCGACCCCGGGCAGTGAGG + Intergenic
1013016442 6:106164458-106164480 GGCCCCGGCTTCTGGCAGTGGGG + Intergenic
1014088389 6:117373538-117373560 GCCACCAGCCCCGGGCAGTGAGG - Intronic
1015955872 6:138597489-138597511 GTACCCGGGACCTGGAAGTGAGG - Intronic
1016864052 6:148748100-148748122 GTCCCGCGCCCCGGGGAGTGTGG + Intronic
1018109414 6:160520519-160520541 GCCGCAGGCTCCTGGCAGTGAGG - Intergenic
1018156612 6:160991564-160991586 CGCCCCGGCCGGTGGCAGTGGGG - Intergenic
1019086216 6:169480144-169480166 GCCACCGGCCCCAGGCAGTGAGG + Intronic
1019197736 6:170291762-170291784 GTCCGCGGCCACTGGGAGTAGGG + Intergenic
1019618362 7:1977368-1977390 GTTGCCGGCCCCGGGCAGTGAGG - Intronic
1020134846 7:5581419-5581441 GTCCCCGGCTTCTTGCAGGGAGG + Intergenic
1021133862 7:16943097-16943119 GCCACCGGCCCCTGGCAGTGAGG + Intergenic
1021359422 7:19692501-19692523 GCCCCCGGCCCAGGGCAGTGAGG - Intergenic
1021567891 7:22032576-22032598 CCCGCCGGCCCCTGGCAGTGAGG - Intergenic
1021573882 7:22090519-22090541 GCCACTGGCCCCAGGCAGTGAGG + Intergenic
1021761284 7:23904963-23904985 CCCACCGGCCCCGGGCAGTGAGG - Intergenic
1026098354 7:67364776-67364798 GCCGCTGGCCCCAGGCAGTGAGG - Intergenic
1026516554 7:71078097-71078119 GTCACCAGCCCCGGGCAGTGAGG + Intergenic
1027238017 7:76309689-76309711 CCCGCCGGCCCCGGGCAGTGAGG - Intergenic
1027269049 7:76510413-76510435 CTCCCTTGGCCCTGGCAGTGGGG + Intronic
1028058748 7:86282412-86282434 GCCGTCGGCCCCAGGCAGTGAGG - Intergenic
1029037907 7:97541318-97541340 GCCGCCAGCCCCGGGCAGTGAGG + Intergenic
1029903959 7:104071907-104071929 CCCACCGGCCCCGGGCAGTGAGG + Intergenic
1030772236 7:113488397-113488419 GCCTCTGGCCCCAGGCAGTGAGG - Intergenic
1031447599 7:121873468-121873490 GTCTGCGGCCCCTCGCCGTGCGG - Exonic
1032288153 7:130559337-130559359 TTCTCCGGCCCCTGGCAGCTGGG - Intronic
1032339637 7:131058871-131058893 GCCGCCAGCCCCAGGCAGTGAGG + Intergenic
1032437110 7:131909435-131909457 GCTGCCGGCCCCGGGCAGTGAGG + Intergenic
1034274772 7:149819316-149819338 GTGCCCTGGCCCTGGCTGTGGGG + Intergenic
1034967119 7:155398401-155398423 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
1035463911 7:159063392-159063414 GCTGCCGGCCCCGGGCAGTGAGG - Intronic
1035701033 8:1639368-1639390 GTCCCTGGGTCTTGGCAGTGTGG + Intronic
1038686901 8:29727186-29727208 CTCCCAGGCCCCTGGCAATGTGG - Intergenic
1039587605 8:38719948-38719970 CCCACCGGCCCCGGGCAGTGAGG + Intergenic
1040000867 8:42575324-42575346 CTGCCGGGCCCCGGGCAGTGAGG + Intergenic
1040583423 8:48716230-48716252 GCCGCCGGCCCCAGGCAGTGAGG - Intronic
1040628018 8:49174882-49174904 CTCCCCAACCCCTGGCAGTGGGG + Intergenic
1040701772 8:50074969-50074991 GCCACTGGCCCCAGGCAGTGAGG + Intronic
1040806846 8:51405059-51405081 GCTGCCGGCCCCAGGCAGTGAGG - Intronic
1040965586 8:53077880-53077902 ACCCCCGGCCCCAGGCAGTGAGG - Intergenic
1042948770 8:74179782-74179804 GCCGCTGGCCCCGGGCAGTGAGG - Intergenic
1044862160 8:96534062-96534084 ACCGCCGGCCCCGGGCAGTGAGG - Intronic
1045678422 8:104633137-104633159 GCCACTGGCCCCAGGCAGTGAGG - Intronic
1046621208 8:116531195-116531217 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1048186894 8:132249909-132249931 GCCGCTGGCCCCAGGCAGTGAGG - Intronic
1048269589 8:133017916-133017938 CTGCCCCGCCCCTGGCAGAGAGG + Exonic
1048370852 8:133774928-133774950 TTCCCCAGCCCCTGGCATTGCGG + Intergenic
1048500396 8:134970032-134970054 GTCCCCAGCCCTTGGCAGGAAGG - Intergenic
1049242738 8:141546659-141546681 ATCCCCATCCCCTGGCTGTGGGG + Intergenic
1049308929 8:141923232-141923254 TACCCCGGCCCCCAGCAGTGAGG + Intergenic
1049611881 8:143559656-143559678 GGCCCCGGCCTCTGGAAGAGAGG - Intronic
1049731556 8:144181005-144181027 TTCCCCTGCCACTGACAGTGGGG + Intronic
1050294899 9:4195405-4195427 GCCACCGGCCCCAGACAGTGAGG + Intronic
1050345319 9:4680004-4680026 GTCCCCGGCCCCTGGCAGTGAGG - Intronic
1050598533 9:7227767-7227789 TTTCCCAGCCCCTGGCAGTTAGG + Intergenic
1053148545 9:35728373-35728395 GTCCGCAACCGCTGGCAGTGGGG + Intronic
1053393397 9:37751985-37752007 CCCGCCGGCCCCAGGCAGTGAGG + Intronic
1055925608 9:81507481-81507503 GCCACCGGCCCCAGGCAGTGAGG + Intergenic
1056461091 9:86810444-86810466 GGGGCCAGCCCCTGGCAGTGGGG + Intergenic
1056711083 9:88992001-88992023 ATCCCCAGGCCCTGGCACTGTGG - Exonic
1056811823 9:89771060-89771082 GTCCAGGGCACCTGGCAGGGAGG + Intergenic
1057706828 9:97400509-97400531 GACCCAGGCCCCTGCAAGTGTGG - Intergenic
1061089881 9:128420667-128420689 GTCCCCGGGCCCTGGCCCTCCGG + Exonic
1062230393 9:135479258-135479280 GACCCCGGCCCAAGGCTGTGGGG + Intronic
1062448813 9:136607034-136607056 GCCTCTGGCCCCTGGCAGGGAGG + Intergenic
1062507850 9:136887027-136887049 TTCCCCGACCCCTGGCTGGGGGG - Intronic
1062629897 9:137458916-137458938 GGCCCCGGCCTCTGCCACTGAGG - Intronic
1203429797 Un_GL000195v1:80472-80494 CCCACCGGCCCCAGGCAGTGAGG + Intergenic
1188242550 X:27809244-27809266 GCCCCCCGGCCCAGGCAGTGAGG + Intronic
1197728797 X:129793631-129793653 GTCCCTGGCAGCTGGCAGTGAGG + Exonic
1199134178 X:144231463-144231485 CCCACCGGCCCCAGGCAGTGAGG - Intergenic
1199622717 X:149714169-149714191 GTCCCCTGTCCTTGGCTGTGTGG + Intronic
1199695000 X:150337525-150337547 CTCCCGGGCTCGTGGCAGTGGGG + Intergenic
1199881157 X:151974903-151974925 CTCCCCCGCCCCTGGCTGTCTGG - Intergenic
1202100595 Y:21303819-21303841 CCACCCGGCCCCAGGCAGTGAGG - Intergenic