ID: 1050345323

View in Genome Browser
Species Human (GRCh38)
Location 9:4680019-4680041
Sequence GGCGTCAGGTCCCAGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 264}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050345323_1050345338 23 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345338 9:4680065-4680087 GGCATCTTCGGAGGGCAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 134
1050345323_1050345331 11 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345331 9:4680053-4680075 CACCCCTTTTATGGCATCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 102
1050345323_1050345336 15 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345336 9:4680057-4680079 CCTTTTATGGCATCTTCGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1050345323_1050345327 2 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345327 9:4680044-4680066 ATGCCATCCCACCCCTTTTATGG 0: 1
1: 0
2: 0
3: 8
4: 101
1050345323_1050345334 14 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345323_1050345340 27 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345340 9:4680069-4680091 TCTTCGGAGGGCAGACGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 131
1050345323_1050345337 22 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345337 9:4680064-4680086 TGGCATCTTCGGAGGGCAGACGG 0: 1
1: 0
2: 0
3: 19
4: 171
1050345323_1050345339 24 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345339 9:4680066-4680088 GCATCTTCGGAGGGCAGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050345323 Original CRISPR GGCGTCAGGTCCCAGGTCCC CGG (reversed) Intronic
900372292 1:2337377-2337399 GGCGGCAGACCCCAGGTCCTCGG + Intronic
901054849 1:6444267-6444289 GGCAGCAGGACCCAGGTTCCTGG - Intronic
901735390 1:11309154-11309176 GGTCGCAGGTCACAGGTCCCAGG + Intergenic
902247155 1:15128611-15128633 GGCGGTTGGTCCCAGGCCCCTGG - Intergenic
902808562 1:18875541-18875563 GGGCTCAGGGCCCTGGTCCCTGG - Intronic
903281993 1:22255330-22255352 GTTGTCAGGTCCCAGAGCCCAGG - Intergenic
904994483 1:34620718-34620740 AGCATAAGGTCCCAGGGCCCTGG + Intergenic
905280417 1:36845712-36845734 GGCCTCAGGTCCAAGGTCCTTGG - Intronic
905298181 1:36967951-36967973 GGCCTCTGTTCCCAGGTACCCGG - Intronic
905880862 1:41463018-41463040 GGCCTGAGGTCCCAGCTACCTGG - Intergenic
906117878 1:43367766-43367788 GGTGGGAGGTCCCAGCTCCCTGG - Intronic
908563649 1:65332033-65332055 GGAACCAGGTCCCAGGTCCCAGG - Intronic
913680560 1:121185092-121185114 CGCGACGGGTCCCAGGCCCCCGG - Exonic
914032391 1:143972734-143972756 CGCGACGGGTCCCAGGCCCCCGG - Intergenic
914157054 1:145095233-145095255 CGCGACGGGTCCCAGGCCCCCGG + Exonic
914944721 1:152053688-152053710 GGCGTGGGGTCCAAGGCCCCGGG - Intergenic
915358814 1:155273316-155273338 GGCGGGAGGTCCCAGGGTCCCGG - Intronic
915597138 1:156902230-156902252 GCCCCCAGGCCCCAGGTCCCAGG + Exonic
915597143 1:156902237-156902259 GGCCCCAGGTCCCAGGCCCCAGG + Exonic
916075156 1:161196376-161196398 GTCCTCAGTGCCCAGGTCCCCGG - Intronic
917721270 1:177788791-177788813 GGCTTCAGGTCTCACCTCCCAGG + Intergenic
919779780 1:201214258-201214280 GGTGCCAGGTCCCAGGTCACTGG - Exonic
919901324 1:202046251-202046273 GTGGGCAGGTCCCAGGTCCCAGG + Intergenic
920043089 1:203116487-203116509 GGAGTGAGGTCAGAGGTCCCTGG + Intronic
920467869 1:206203618-206203640 CGCGACGGGTCCCAGGCCCCCGG - Intronic
921874359 1:220177116-220177138 GACTTCTGGACCCAGGTCCCTGG + Intronic
922455232 1:225768853-225768875 GTCGTCAGGACGCAGGGCCCGGG - Intergenic
922898503 1:229118865-229118887 GGCATCAGGTGCCAGGTCCGGGG + Intergenic
923115981 1:230938369-230938391 CCCGTCAGGTTCCAGGCCCCCGG + Intronic
924527121 1:244863210-244863232 GGGGAGAGGCCCCAGGTCCCGGG - Intronic
924618835 1:245642137-245642159 GTCTTCAGGACTCAGGTCCCTGG - Intronic
1062867219 10:865832-865854 AGGGACAGGTCCCTGGTCCCCGG + Intronic
1063113772 10:3058454-3058476 AGCGACAGGTCACAGGTCCGTGG + Intergenic
1063824119 10:9875308-9875330 GGCCTCAGGCCCTAGGGCCCAGG + Intergenic
1064031840 10:11887617-11887639 GGCCTCTGGACCCAGGACCCAGG - Intergenic
1064291999 10:14043803-14043825 GGTGTCCGGTCCCAGATCTCTGG + Intronic
1064918308 10:20486972-20486994 GTGGTCAGGTCCCAGCTGCCAGG - Intergenic
1065919953 10:30384594-30384616 TGTGTCAGGTCCCAGGGTCCAGG + Intergenic
1067247636 10:44559692-44559714 GGCATCAGTCCCCTGGTCCCTGG + Intergenic
1069634860 10:69918897-69918919 GGCATCAGGTCCCAGGCCAAAGG - Intronic
1069680777 10:70283837-70283859 GGCGTGCGCTCCCAGGCCCCGGG + Intergenic
1069739712 10:70679624-70679646 GGCATCAGGCCCCAGGGCCTGGG - Intronic
1069814626 10:71185961-71185983 GGCCCCAGGCCCCAGGCCCCAGG - Intergenic
1073130607 10:101186596-101186618 GGCGTCAGATCCCATCTCTCAGG - Intergenic
1074546355 10:114404594-114404616 GGGGCCAGGTCCGAGGACCCTGG - Intronic
1074886986 10:117701614-117701636 AGCATCAGGGCCCAGGGCCCAGG - Intergenic
1075256614 10:120930575-120930597 GGCAACAGGTTCCTGGTCCCAGG - Intergenic
1075304363 10:121354674-121354696 GAAGTCTGGTCCCAGGCCCCAGG - Intergenic
1076495196 10:130892642-130892664 GGGGCCAGGTCTCAGGTCACAGG + Intergenic
1077231460 11:1459764-1459786 AGAGTCATGTCCCGGGTCCCTGG - Intronic
1077490286 11:2857953-2857975 GGGGTCAGTCCCCAGGCCCCTGG + Intergenic
1077551491 11:3202463-3202485 GGCCTGAGGTCCAGGGTCCCTGG - Intergenic
1078104714 11:8351332-8351354 GGGGTCAGGACCCAGCTCGCAGG - Intergenic
1079224887 11:18596413-18596435 GTCTTCAGGACCCAGGACCCAGG + Intergenic
1079592210 11:22193762-22193784 GGTCACAGGTCGCAGGTCCCTGG - Intronic
1082179425 11:49100520-49100542 GGCTTCAGGTCCAAGATTCCAGG + Intergenic
1082733073 11:56824335-56824357 GGCGTGAGCTCCCAGGTCTTGGG + Intergenic
1083251697 11:61472171-61472193 GGCCTCAGCTCCCACTTCCCGGG - Intronic
1084145962 11:67265593-67265615 GTTGTCAGGTCCCAGGTTCTGGG + Intergenic
1085020263 11:73202181-73202203 GGTCTCAGGTCTCAGGTCTCGGG + Intergenic
1085475960 11:76789052-76789074 GGCATCAGGTCCCAGGTCCTGGG + Intronic
1086685857 11:89732397-89732419 GGCTTCAGGTCCAAGATTCCAGG - Intergenic
1089353056 11:117832239-117832261 GGTTGCAGGTGCCAGGTCCCTGG + Intronic
1089363093 11:117903917-117903939 GGGCTCAGGTCCCAGCACCCTGG - Intronic
1092045540 12:5430053-5430075 GCAGGCAGCTCCCAGGTCCCTGG - Intergenic
1093389584 12:18602328-18602350 GGCGTGAGGTCCCGGGTCACTGG - Intronic
1093409275 12:18845283-18845305 GGGGTAAGGTCCCAGGTCAATGG + Intergenic
1102619003 12:114178783-114178805 AGCCTCAGGTTCCAGGTCCGGGG - Intergenic
1102878586 12:116466899-116466921 TGAGTCAGGTCCCTGGTGCCTGG + Intergenic
1104030937 12:125065497-125065519 TTCCTCCGGTCCCAGGTCCCCGG + Exonic
1104902357 12:132196425-132196447 TGCGGCAGGGCCCAGGTGCCTGG + Exonic
1104992906 12:132636210-132636232 GGCGCCAGCTCCCAGGGGCCTGG - Intronic
1105654724 13:22423842-22423864 GTCGTCAGGCCTCAGTTCCCTGG - Intergenic
1109443738 13:62406727-62406749 GGATTCAGGCACCAGGTCCCTGG + Intergenic
1111536880 13:89612959-89612981 GGCCTGTGGTCCCAGGTCCTTGG + Intergenic
1112799999 13:103100043-103100065 GGCGTCAGGACCGTGGTCCAGGG - Intergenic
1115398954 14:32938024-32938046 GCAGTCCGGTCCCAAGTCCCGGG + Intronic
1119742947 14:77026207-77026229 GGCGGCAAGGCCCCGGTCCCCGG + Exonic
1122251713 14:100444550-100444572 GGCCCCAGGCCCCAGGCCCCAGG + Intronic
1122388313 14:101363925-101363947 GGAGACAGGTGCCAGGTCACGGG - Intergenic
1122411261 14:101527282-101527304 AGCGTGAGGTCCCAGGCACCCGG + Intergenic
1122427450 14:101620202-101620224 GGCTTCAGGTCCAGGGCCCCTGG + Intergenic
1123032632 14:105459029-105459051 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032716 14:105459265-105459287 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032738 14:105459324-105459346 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032781 14:105459442-105459464 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032844 14:105459619-105459641 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032886 14:105459737-105459759 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1123032908 14:105459796-105459818 GGCCCCTGGTCCCTGGTCCCTGG + Intronic
1202896952 14_GL000194v1_random:15868-15890 GACATCAGGTTCCAGGTTCCAGG + Intergenic
1124662580 15:31562384-31562406 GGCACCAGGTACCAGGTACCAGG - Intronic
1127652815 15:61025362-61025384 GGGCTGTGGTCCCAGGTCCCGGG + Intronic
1129293208 15:74584482-74584504 GGGGTGAGGGCCCAGGACCCAGG - Intronic
1129334643 15:74844701-74844723 GGAGTCAAGGCCCAGGACCCTGG + Exonic
1129716573 15:77855212-77855234 GTCTTCAGGCCCCAGGTCCCAGG - Intergenic
1130025927 15:80270438-80270460 GGCCTCAGGTCCCACCACCCTGG + Intergenic
1130275223 15:82472802-82472824 GGCGGCAGGACCCAGCTCCTGGG + Intergenic
1130467584 15:84200197-84200219 GGCGGCAGGACCCAGCTCCTGGG + Intergenic
1130496681 15:84473345-84473367 GGCGGCAGGACCCAGCTCCTGGG - Intergenic
1130589876 15:85204795-85204817 GGCGGCAGGACCCAGCTCCTGGG + Intergenic
1132468585 16:89313-89335 GTTGCCAGGTCCCAGGTCCCCGG - Intronic
1132522455 16:397800-397822 GACGTCAGGCCCCAAGTCCCCGG + Intronic
1132607801 16:800783-800805 GGCGCCAGGGCCCAGGTGGCGGG - Intergenic
1132609045 16:805966-805988 GGCATCTGGTCTTAGGTCCCAGG + Intronic
1132732627 16:1370343-1370365 CCCGCCAGGTCCCAGGTCGCTGG - Intronic
1133078090 16:3295325-3295347 GGGGTCTGGGCACAGGTCCCGGG - Intronic
1135074926 16:19384903-19384925 GGTGCCAGGTGCCAGGTGCCAGG - Intergenic
1136360470 16:29776115-29776137 GGGGTCAGGCACTAGGTCCCTGG + Intergenic
1137552980 16:49453149-49453171 GGCTACAGATCCCAGGCCCCTGG - Intergenic
1140387255 16:74552222-74552244 GGCTGCAGGGCCCAGGTCCGGGG - Intronic
1141468274 16:84221485-84221507 GGTCCCAGGTCCCAGGTCCCAGG + Exonic
1141820563 16:86442572-86442594 GGAGTCAGGTCACAGGGCCTGGG + Intergenic
1142100107 16:88266368-88266390 GGTGTCAGGCCCCAGGCTCCAGG + Intergenic
1142103942 16:88292033-88292055 GGTGTCAGGTCCCAGGAGTCTGG + Intergenic
1142586601 17:978725-978747 GGCCTCGGCCCCCAGGTCCCCGG + Intronic
1142586603 17:978732-978754 GCCCCCAGGTCCCCGGTCCCCGG + Intronic
1144650701 17:17005110-17005132 GCCCTCAGGTCCCAGGGGCCCGG + Intergenic
1144703669 17:17353907-17353929 GGGGTCACTTCCCAGGGCCCTGG - Intergenic
1144783472 17:17819355-17819377 GGCGGCAGGTCTCAGTCCCCTGG - Exonic
1145863356 17:28225627-28225649 GGCTTCCGGTCCCTGCTCCCAGG + Intergenic
1146283406 17:31559390-31559412 GGCGGCGGCCCCCAGGTCCCGGG + Intergenic
1146656698 17:34638817-34638839 AGAGTCAGCTCCCAGGTCCTGGG - Exonic
1147382369 17:40063256-40063278 GGCGTCAGTTGCAAGCTCCCGGG - Intronic
1147662943 17:42126894-42126916 GGGGCCAGGGCCCAGGGCCCAGG + Intronic
1147772484 17:42877615-42877637 GTCATCTGGTCCCAGGGCCCTGG + Intergenic
1148796488 17:50199705-50199727 GGCCCCAGGCCCCAGGCCCCAGG + Intronic
1148796492 17:50199712-50199734 GGCCCCAGGCCCCAGGCCCCAGG + Intronic
1152317813 17:79591050-79591072 GGCGACAGCTCCCTGCTCCCAGG - Intergenic
1152586148 17:81190350-81190372 GGAGTCAGCTCCCGGGGCCCTGG - Intronic
1152737577 17:82004958-82004980 GGCAGCAGGTCGCAGGTCCATGG - Intronic
1155325829 18:24664039-24664061 GGAGTCTGGCCCCAGATCCCAGG + Intergenic
1160230704 18:77046660-77046682 AGCGACAGGTCCCAGTCCCCCGG + Intronic
1160910362 19:1471139-1471161 GGCTCCAGGTCCCAGGGCCTCGG - Exonic
1160969832 19:1762641-1762663 GGCGCGTGGTCCCGGGTCCCGGG - Intronic
1161335045 19:3708509-3708531 GGCAGCAGGTGCCAGGGCCCGGG - Intronic
1161997058 19:7719709-7719731 AGAGTCAGGTCCCAGGCCCCAGG - Intergenic
1162112059 19:8404688-8404710 GGCCTGAGGTCCTAGGACCCAGG - Intronic
1162506853 19:11090641-11090663 GACGACAAGTCCCGGGTCCCCGG + Intronic
1162584251 19:11549493-11549515 GCCGTCAAGGCCCAGGACCCTGG + Intronic
1163201763 19:15774697-15774719 GGAGACATGCCCCAGGTCCCAGG - Intergenic
1163426500 19:17243683-17243705 GGAGTTTGGCCCCAGGTCCCGGG - Intronic
1163694802 19:18758726-18758748 GGCATCAGGTCCAAGCTTCCTGG + Intronic
1165070322 19:33251671-33251693 GGCAGCAGGTCAGAGGTCCCCGG - Intergenic
1165725432 19:38109572-38109594 AGAGTCAGATCCCAGGTCACTGG - Intronic
1165912382 19:39237223-39237245 TGCCTCAGGTCCCAGGTCCTGGG + Intergenic
1165913566 19:39244424-39244446 TGCCTCAGGTCCCAGGTCCTGGG + Exonic
1165917399 19:39269200-39269222 TGCCTCAGGTCCCAGGTCCTGGG - Exonic
1165920796 19:39296853-39296875 AGCCTCAGGTCCCAATTCCCGGG - Exonic
1166387523 19:42390456-42390478 TGCCTCAGCTCCCAGGACCCAGG + Intergenic
1167269059 19:48497968-48497990 GGCGTCTTCTCCCAGGGCCCTGG + Exonic
1167611574 19:50510415-50510437 GACGGCATGTCCCAGGCCCCGGG - Exonic
1168296034 19:55377724-55377746 GGCTCCTGGCCCCAGGTCCCTGG + Intronic
1168324325 19:55530335-55530357 GGGGTCAGGGCCCAGTGCCCCGG + Intronic
1168404174 19:56102346-56102368 CATGTCAGGCCCCAGGTCCCAGG - Intronic
1168691360 19:58379513-58379535 GGCTCTGGGTCCCAGGTCCCAGG + Intronic
925129529 2:1484621-1484643 GGCCTCGGGTCCCAGGATCCTGG - Exonic
929090643 2:38213954-38213976 GGGAGCAGGTGCCAGGTCCCGGG + Intergenic
930518745 2:52436856-52436878 GGCTTCACCTCCCAGGTCTCAGG - Intergenic
932134839 2:69219155-69219177 GGAGGCAGTCCCCAGGTCCCTGG + Intronic
932293464 2:70604873-70604895 TTCCTTAGGTCCCAGGTCCCTGG + Intergenic
935068913 2:99676461-99676483 TGAGGCAGGTCCCAGGGCCCTGG - Intronic
937940627 2:127282891-127282913 AGCCCCAGGTCCCAGGTTCCAGG - Intronic
938137824 2:128773862-128773884 GGGGTCAAGTTCCAGGGCCCAGG - Intergenic
938378530 2:130823924-130823946 GGCCTGTGGTCCCAGATCCCAGG + Intergenic
943876527 2:193073384-193073406 GGCATCAGGTCTGAGGTCTCAGG - Intergenic
944647548 2:201794910-201794932 GTCCACAGGTCCCAGGTCACTGG - Intronic
946062000 2:216950459-216950481 CGTGTCAGCTCCCAAGTCCCAGG + Intergenic
947858961 2:233345327-233345349 AACGTCAAGTCCCAGGTCTCAGG + Intronic
948395489 2:237642347-237642369 GGCCTCAGGTTCCCAGTCCCAGG + Intronic
948395540 2:237642528-237642550 GGTTTCAGGTTCCAGGTTCCAGG + Intronic
948395589 2:237642737-237642759 GGTTTCAGGTTCCAGGTCCCAGG + Intronic
1169045100 20:2528737-2528759 GCCCTCAGGTCCCAGATACCTGG + Intergenic
1169224516 20:3847617-3847639 TGCCACAGGTCCCAGGTCGCTGG - Intronic
1171351200 20:24504555-24504577 AGCCTCAGGTCCCAGCCCCCAGG - Intronic
1171896498 20:30814224-30814246 GGCGTCAGGGCCCAGGGCCCAGG + Intergenic
1173314462 20:41930977-41930999 GGGGTGAGATCCCAGGGCCCTGG + Intergenic
1173337289 20:42123052-42123074 GGTGGCATGTCCCATGTCCCAGG - Intronic
1173522269 20:43709121-43709143 GGCCTCATCACCCAGGTCCCTGG + Intronic
1173932554 20:46832904-46832926 TGGGTGAGGTCCCAGCTCCCAGG + Intergenic
1175691385 20:61068221-61068243 GGACGCAGGTCCCAGGACCCAGG - Intergenic
1175870775 20:62208433-62208455 GGCCCCAGGGTCCAGGTCCCAGG + Intergenic
1175890656 20:62314476-62314498 GGTGCCTGGTCCCTGGTCCCCGG - Intronic
1175900885 20:62359476-62359498 GGCCCCAGGCCCCAGGCCCCAGG - Intronic
1175904847 20:62374729-62374751 GGCCTCCGGTCCCTGGTCCCTGG - Intergenic
1175961407 20:62638567-62638589 GGTCTCAGGTCTCAGGTCTCAGG - Intergenic
1175974564 20:62704005-62704027 GGCTCCAGCTCCCAGGTCTCCGG + Intergenic
1176728593 21:10466050-10466072 GCCCTCAGGTCCCACTTCCCAGG - Intergenic
1179243091 21:39609056-39609078 GGGTTCAGCTCCCAGTTCCCCGG + Intronic
1179617976 21:42593925-42593947 AGGGTCAGGACCCAGGTACCAGG + Intergenic
1179957374 21:44749190-44749212 GGTGTCAGGGACCAGGACCCTGG + Intergenic
1180146381 21:45922108-45922130 GCTCTCAGGTCCCAGGTCTCAGG - Intronic
1180228399 21:46411990-46412012 GGCGCCAAGGCCCAGGTCACCGG + Exonic
1180737058 22:18024881-18024903 GGCTTCAGCACCCAGGTCTCCGG + Intergenic
1181799179 22:25333175-25333197 AGGGTCAGGACACAGGTCCCAGG + Intergenic
1181936571 22:26443031-26443053 GGAGTCAGGACCCAGGATCCAGG - Intronic
1182435784 22:30328835-30328857 GGCTCCTGGTCCCAGCTCCCAGG + Intergenic
1183209010 22:36438719-36438741 GGCTTCAGGAACCAGGTGCCTGG - Intergenic
1184287270 22:43478720-43478742 GCCGCCAGAACCCAGGTCCCTGG + Intronic
1184306743 22:43608192-43608214 GGCTTGAGCTCCCAGGTCCTTGG + Intronic
1184347334 22:43921913-43921935 AGGGTCAGGTCCTAAGTCCCGGG - Intergenic
1184697839 22:46149998-46150020 GGCACCCGGTCCCGGGTCCCGGG + Intergenic
1184792181 22:46707067-46707089 GGGGTGAGGTCACAGGTCACCGG - Intronic
1184798768 22:46747681-46747703 TGCTTCAAGTCCCACGTCCCGGG + Intergenic
950548302 3:13652086-13652108 GGCATCAAGTCCCAGTTCCATGG + Intergenic
950548880 3:13654783-13654805 GGCATCAGGACCCAGGGCACCGG + Intergenic
950579643 3:13853903-13853925 CCCTGCAGGTCCCAGGTCCCAGG - Intronic
952919735 3:38276245-38276267 GGCGTCAGGGCCCAGGTGATGGG + Intronic
954538849 3:51380789-51380811 GCCCCCTGGTCCCAGGTCCCAGG - Intronic
954688252 3:52382268-52382290 AGCGTCTGGCCCCAAGTCCCTGG + Intronic
961202471 3:125055787-125055809 GGCGGCGGGTCCCGCGTCCCGGG + Exonic
965210332 3:165778624-165778646 GGAGTCAGGGCCCAGGACCATGG - Intronic
968134486 3:196211244-196211266 TGCCTCTGGTCCCACGTCCCTGG - Exonic
968601688 4:1512803-1512825 GGGGTCAGGGACCAGGTCCCTGG + Intergenic
969294756 4:6263336-6263358 GGGCACAGGTCTCAGGTCCCAGG - Intergenic
969436659 4:7192810-7192832 GGCGTGAGGACCCAGGCGCCCGG - Exonic
969459996 4:7323985-7324007 GGCCTCAGATCCTAGGACCCAGG - Intronic
970520228 4:16876029-16876051 GGGGCCATGTCCCATGTCCCTGG + Intronic
975420390 4:74157910-74157932 GGGGCCAGGACCCAAGTCCCGGG - Intronic
977577384 4:98689925-98689947 GGCCTCAGGTCCCTGGTGGCTGG - Intergenic
978034216 4:103974422-103974444 AGCTTCAGGTTCCAGGTCCAGGG - Intergenic
980464033 4:133151129-133151151 GGCGTTGGGGCCCAGGTCCTTGG - Exonic
983209077 4:164940155-164940177 GGAGGCAGGTCCCAGGGCACTGG + Intergenic
983620699 4:169758026-169758048 CGCGTCCGGTGCCAGGTCTCAGG - Intergenic
983914284 4:173274964-173274986 GGCGTCAGGTCCTATGACCGTGG - Intronic
985477519 5:86577-86599 GGTTTCATGTCCCAGGTCCAAGG - Intergenic
985611390 5:891567-891589 GGAGCCTGGTCCCAGGACCCAGG - Intronic
985774085 5:1831645-1831667 AGCGCCAGGCCCCAGGCCCCAGG - Intergenic
985933915 5:3080135-3080157 GGTGGCTGGTCCCAGGTCCGTGG + Intergenic
987051162 5:14147275-14147297 AGAGTCAGGGCCCTGGTCCCTGG + Intronic
991603125 5:68373225-68373247 GGTCTCAGGTCCCAGGTCCCAGG - Intergenic
991603127 5:68373232-68373254 AGCCTGAGGTCTCAGGTCCCAGG - Intergenic
995297996 5:110542080-110542102 AGCTTCAGGTTCCAGGTCCGGGG - Intronic
997587890 5:135054598-135054620 GGAATCAAGTCCCAGGCCCCAGG - Intronic
999710200 5:154311568-154311590 GGTTTCAGGTCTCAGGTCTCAGG - Intronic
1002418770 5:179134849-179134871 GGCTCCAGCTCCCAGCTCCCGGG + Intronic
1002418840 5:179135048-179135070 GGCTCCAGCTCCCAGCTCCCGGG + Intronic
1002566397 5:180114632-180114654 GGGGTCGGGTCTGAGGTCCCTGG - Intronic
1003119792 6:3309915-3309937 GGCCTTAAGTCCCAGGTTCCAGG - Intronic
1006372963 6:33656751-33656773 GGCAACAGGGCCCAGGGCCCAGG - Intronic
1007451088 6:41940905-41940927 GGGGTGAGGTCCCAGCTCTCTGG - Intronic
1016040391 6:139426902-139426924 GGAGTCAAGTCCAATGTCCCTGG + Intergenic
1016431024 6:143986133-143986155 AGAGTCTGGTCCCAGGTTCCAGG - Intronic
1017881458 6:158565414-158565436 GGCCTCAAGGACCAGGTCCCAGG + Intronic
1018374804 6:163200937-163200959 GGCCCCAGGCCCCAGGCCCCAGG + Intronic
1018837557 6:167496852-167496874 GGGGCCAGGTCCCAGGGCCGGGG - Intergenic
1018909838 6:168095613-168095635 AGCGACAGGTGCCGGGTCCCGGG - Intergenic
1019344959 7:525078-525100 TGCCTAAGGTCCCAGGTCCTCGG + Intergenic
1019383463 7:740341-740363 GGCGTCTGGTCCCAGAGCCCAGG - Intronic
1019481379 7:1268432-1268454 GGGGCCAGGTGCCAGGTGCCAGG + Intergenic
1021852601 7:24823120-24823142 GCAGTCAGGGCCCAGGTCCATGG - Intronic
1028984103 7:96996673-96996695 GGTCCCGGGTCCCAGGTCCCAGG + Intergenic
1029424110 7:100485938-100485960 GAGGCCAGGCCCCAGGTCCCTGG - Intronic
1029653927 7:101912052-101912074 GGCCCCTGGTCCCAGGTCCCAGG - Intronic
1030983292 7:116210867-116210889 GGGGCCAGGTCCCTGGGCCCGGG - Intronic
1031122159 7:117734115-117734137 CGTCTCAGGTCCCAGGTCCAGGG - Intronic
1033450049 7:141454472-141454494 GGGGTCAGGGCCCAAGACCCAGG + Intronic
1034257175 7:149731060-149731082 GGAGACAGGTCCCAGTTGCCTGG + Intronic
1035412196 7:158653973-158653995 GGCGTCAGGGGCCAGGGACCAGG + Intronic
1036442918 8:8797318-8797340 GGGATCAGGAGCCAGGTCCCGGG + Intronic
1037976752 8:23219326-23219348 CGCCTCAGGTCACAGGTTCCAGG + Intronic
1039159016 8:34595973-34595995 GGCTTCAGGGGCCAGGTCCATGG - Intergenic
1040007419 8:42632170-42632192 GGGGTCAGGCTCCAGGTCTCTGG - Intergenic
1042089260 8:65140870-65140892 GGAGTCAGGTGCCCAGTCCCAGG + Intergenic
1042787655 8:72567184-72567206 GGTGGCACGTCCCAGGTACCTGG + Intronic
1043684617 8:83070264-83070286 AGCTTCAGGTTCCAGGTCCAGGG - Intergenic
1047432485 8:124805011-124805033 TGCCTCAGGTCCCTGGTCTCAGG + Intergenic
1049388754 8:142357528-142357550 GGCGGCAGGAACCAGGGCCCGGG + Intronic
1049474373 8:142789980-142790002 AGAGACAGGGCCCAGGTCCCAGG + Intergenic
1049773139 8:144392941-144392963 TGGGTCAGGTCACAGGTCACAGG - Intronic
1049774584 8:144398489-144398511 AGCCCCAGGTCCCAGGTCCCAGG + Intronic
1050345323 9:4680019-4680041 GGCGTCAGGTCCCAGGTCCCCGG - Intronic
1050345324 9:4680026-4680048 GGCATCAGGCGTCAGGTCCCAGG - Intronic
1057781899 9:98056945-98056967 GGCGGCAGCTCCCGGGACCCGGG + Intronic
1060096217 9:120793161-120793183 GGCGCGAGGTCCCGGGCCCCGGG - Exonic
1060749630 9:126160583-126160605 GGAGTCTGATCCCAGGTCCTCGG - Intergenic
1060956121 9:127641451-127641473 GGTTCCAGGTCCCAGGTCTCAGG - Intronic
1061249550 9:129418495-129418517 GGAGGCAGATCCCAGGGCCCAGG - Intergenic
1061285576 9:129620531-129620553 GGCGCCAGGTCCTGGGCCCCTGG + Exonic
1061286510 9:129626371-129626393 GCCCTGAGGTCCCGGGTCCCCGG + Intronic
1061921655 9:133785742-133785764 GGCGGCAGCCCCCAGGTCCCTGG - Intronic
1062116176 9:134810330-134810352 CGCGGCAGCCCCCAGGTCCCGGG + Intronic
1062280864 9:135751062-135751084 GGCGCGGGGTCCCGGGTCCCAGG + Intronic
1062307977 9:135920344-135920366 AGGGTCACCTCCCAGGTCCCTGG - Intergenic
1062705070 9:137934208-137934230 AGCTTCAGGTTCCAGGTCCAGGG + Intronic
1192234104 X:69285324-69285346 GGGATCAGGCCCCAGGTCTCTGG + Intergenic
1197936830 X:131748035-131748057 GGAGCCAGGTCCAAGATCCCTGG - Intergenic
1199673733 X:150167095-150167117 GGAGTCAGGGCCCAAGTCACTGG + Intergenic
1200064517 X:153498040-153498062 AGGGTCAGGTCCCGGCTCCCTGG + Intronic
1200753436 Y:6967955-6967977 GGCTTGAAGTCCCAGGTCACGGG + Intronic
1201065065 Y:10089298-10089320 GGCATTAGGGCCCAGGGCCCAGG + Intergenic