ID: 1050345325

View in Genome Browser
Species Human (GRCh38)
Location 9:4680033-4680055
Sequence GTGGGATGGCATCAGGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050345325_1050345334 0 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345325_1050345331 -3 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345331 9:4680053-4680075 CACCCCTTTTATGGCATCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 102
1050345325_1050345337 8 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345337 9:4680064-4680086 TGGCATCTTCGGAGGGCAGACGG 0: 1
1: 0
2: 0
3: 19
4: 171
1050345325_1050345338 9 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345338 9:4680065-4680087 GGCATCTTCGGAGGGCAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 134
1050345325_1050345336 1 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345336 9:4680057-4680079 CCTTTTATGGCATCTTCGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1050345325_1050345339 10 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345339 9:4680066-4680088 GCATCTTCGGAGGGCAGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 86
1050345325_1050345340 13 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345340 9:4680069-4680091 TCTTCGGAGGGCAGACGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050345325 Original CRISPR GTGGGATGGCATCAGGCGTC AGG (reversed) Intronic
902052742 1:13577100-13577122 CTGGGATGGCATGAGGCTTGTGG + Intergenic
902209678 1:14895505-14895527 CTGGGATCACATCAGGGGTCTGG + Intronic
903169239 1:21541852-21541874 GTGGCTTGGCACCAGGCCTCTGG + Intronic
903883952 1:26530471-26530493 GTGGGATGGCACCACCCGTCTGG + Intronic
904859551 1:33525105-33525127 GTGGGCTGGGATCAGTCATCAGG - Intronic
908088488 1:60662008-60662030 GTGGGTTGGCATCTGGGGTGGGG - Intergenic
1063481858 10:6383424-6383446 GCAGGATGGCATCGGGCATCTGG - Intergenic
1063921851 10:10941284-10941306 GGGGGATGGCATCAGGACCCTGG - Intergenic
1067030532 10:42876619-42876641 GTGGGAAGCCATAAGGCGCCTGG + Intergenic
1068253990 10:54484125-54484147 GTGGGCTGGCATCACTCGTTGGG - Intronic
1068314253 10:55320627-55320649 GGGGGGTGGCATCAGGCCCCTGG - Intronic
1070144060 10:73760822-73760844 TTGGGATGGCATCAGGGTCCAGG - Exonic
1070749529 10:78955718-78955740 GGGGGACTGCAGCAGGCGTCAGG + Intergenic
1070927716 10:80236600-80236622 GAGGGATGGCATGAAGGGTCAGG - Intergenic
1072478434 10:95786100-95786122 GTGGGAGGACATAAGGGGTCAGG - Intronic
1075627178 10:123972116-123972138 GTGGGATCGACTCAGGAGTCAGG - Intergenic
1075931458 10:126300280-126300302 GTGGGATGGGATCAGGCAGGTGG - Intronic
1078480271 11:11669287-11669309 GTGGGATGGGGTCAGGAGTAGGG - Intergenic
1085011219 11:73142635-73142657 GAGGGAGGGCAGGAGGCGTCTGG - Intergenic
1090528651 11:127565121-127565143 CTGGGATGAGGTCAGGCGTCTGG + Intergenic
1093785729 12:23189840-23189862 CTGGGATGGAAGCAGGGGTCTGG + Intergenic
1104407658 12:128531778-128531800 GGGGGATGGCACAAGGGGTCAGG + Intronic
1106174921 13:27322108-27322130 GTGAGGTGGCATCAGGAGACTGG - Intergenic
1108180660 13:47836854-47836876 GGGGAATGGCAGCAGGTGTCAGG + Intergenic
1109966889 13:69711958-69711980 ATTGGATGGCATTAGTCGTCAGG - Intronic
1111777054 13:92677757-92677779 GTGGGGTGGCGTCAGGTTTCAGG - Intronic
1117895759 14:60485359-60485381 GTGGGATTGCAACAAGCATCCGG + Intronic
1121746945 14:96304044-96304066 GTGTGATGCCATCAGTAGTCTGG + Intronic
1122854879 14:104555240-104555262 CTGGGATGGGCTCAGGGGTCTGG - Intronic
1126115350 15:45202705-45202727 GTGGGCTGGAATAAGGTGTCAGG + Intergenic
1126767095 15:52019728-52019750 GCGGGACGGCAGCAGGCGTGCGG - Intronic
1128093667 15:64936336-64936358 CTGGGCTGGCATCAGGATTCTGG - Intronic
1128392449 15:67191375-67191397 GTGGGATGGCATTTGGTCTCAGG + Exonic
1136533027 16:30882583-30882605 GAGAGATGGCAGCAGGCATCTGG + Intronic
1138414444 16:56863396-56863418 CTGGGATGGCTTCAGGAGCCAGG + Intergenic
1142345898 16:89553851-89553873 TTGGGATGGCACCTGGCATCGGG + Exonic
1144234418 17:13243685-13243707 CTGGAATGGATTCAGGCGTCGGG + Intergenic
1146538385 17:33673201-33673223 ATGGGATGACAACAGGCCTCAGG + Intronic
1147818640 17:43228559-43228581 GTGGGATGGTATGAGGCCCCAGG + Intergenic
1147831923 17:43303261-43303283 GTGGGATGGTATGAGGCCCCAGG + Intergenic
1148645302 17:49216715-49216737 GTGGGAAGGCATCTTGTGTCAGG + Intronic
1152327016 17:79647599-79647621 GTGGGATGGCCCCAGGCTCCCGG - Intergenic
1153940776 18:9974534-9974556 GTGGGAAGGAATGAGGCCTCAGG + Intergenic
1156309200 18:35907286-35907308 CTTGGATAGCATCAGGTGTCTGG - Intergenic
1157809611 18:50685251-50685273 GTTGGCTGGCATCAGGGGCCTGG + Intronic
1160936545 19:1598864-1598886 GTGGCATGGCCTCAGGCCTCAGG + Intronic
1161908760 19:7177046-7177068 GTTTGATGGCATCAGGCTGCAGG - Intronic
1162796895 19:13091744-13091766 CTGGGCTGGCACCAGGCTTCAGG + Intronic
1163437906 19:17306197-17306219 GTGGGGAGGCCCCAGGCGTCTGG - Exonic
1167654743 19:50756174-50756196 GTGGGATGGAAGCAGGAGGCCGG - Intergenic
1167656422 19:50767253-50767275 GTGGGATGGAAGCAGGAGGCCGG - Intergenic
926789532 2:16556364-16556386 CTGGGATGGCATCAGGCCCAGGG + Intronic
927519999 2:23692948-23692970 CTGGGCTGGGGTCAGGCGTCAGG - Intronic
927932739 2:27055718-27055740 GCAGGACGGCATCAGGCTTCAGG - Exonic
936285569 2:111178747-111178769 GAGGGATGCTATCAGGGGTCTGG - Intergenic
938802618 2:134777027-134777049 GTGGGATGGCAGCATGTGTGAGG + Intergenic
939628024 2:144502405-144502427 GTGGGATGGCATCTGCCAGCAGG - Intronic
940249987 2:151664539-151664561 TTGCAATGGCATCAGGCCTCAGG + Exonic
946091046 2:217224167-217224189 GTGGGATGGCCACTGGAGTCTGG - Intergenic
947744262 2:232499591-232499613 GTGGGATGGCCTCTGGAGTTGGG - Intergenic
948106882 2:235421568-235421590 GAGGGAAGGCATCAGGAGTCAGG - Intergenic
1169326301 20:4679411-4679433 GTGGGAAGGCATCAGCATTCTGG + Intergenic
1175175415 20:57108938-57108960 GCGTGCTGGCATCAGGCGCCAGG - Intergenic
1176136207 20:63523089-63523111 GTGGGAAGGCATCTGGCTTGTGG + Intergenic
1178486927 21:33025362-33025384 GTGAGATGGGAACAGGCGGCGGG + Intergenic
1180085586 21:45506697-45506719 GTGGGAGGGCTCCAGGAGTCAGG - Intronic
1182062274 22:27406787-27406809 GTGGGCTGCCATCAGGGGTCTGG + Intergenic
1185059043 22:48596339-48596361 CTGGGATGGCATCAGGGCTAAGG + Intronic
1185408742 22:50672159-50672181 GTGGGTTGGCAGGAGGCGGCTGG + Intergenic
949346905 3:3085058-3085080 GTGGGATGACCACAGGCGTGAGG + Intronic
950531778 3:13556474-13556496 GTGGGATGGTATCAGGGGGTGGG - Intronic
952395956 3:32921047-32921069 GATGGATGGCTTCAGGCATCTGG - Intergenic
957388687 3:79532835-79532857 GTGAGATGGCTTCTGGAGTCAGG - Intronic
965118627 3:164522185-164522207 CTGGGATGGCCTGAGGCATCAGG - Intergenic
968574359 4:1358117-1358139 GTGGGATGGCAGCAGGCCCTGGG - Intronic
969414495 4:7049829-7049851 GTGGGATGCCAACAGCCCTCGGG - Intronic
969447791 4:7255539-7255561 GGGAGAAGGCATCAGGCTTCAGG - Intronic
969551385 4:7870274-7870296 GTGGGATGGCCGAAGGAGTCTGG + Intronic
970661739 4:18293082-18293104 GTGGGATGGCAGCAGGCATTTGG + Intergenic
972426936 4:38942356-38942378 GTGGGATGGCATCAGCCAGAAGG + Intronic
984558329 4:181240499-181240521 GTGTGATGGCATCAGGTCCCAGG + Intergenic
998510637 5:142711296-142711318 GTGGGAAGGCCTCAGGCGGAAGG + Intergenic
1001512564 5:172334193-172334215 GTGGGGTGGCATCTGGTTTCTGG - Exonic
1006628269 6:35412967-35412989 GTGGGATGTCATGAGGATTCAGG + Intronic
1010941335 6:81921428-81921450 TTGGTATGGCATCAGGAGTGTGG - Intergenic
1013366524 6:109441645-109441667 CTGGGATGACAACAGGCTTCAGG - Intronic
1015728351 6:136322827-136322849 GTGGGGTGGCAGCAGGGGTTAGG - Intergenic
1017459550 6:154636290-154636312 GTGTGATGGCATTAGGAGTGGGG + Intergenic
1024242690 7:47447744-47447766 GTGGGATGGGATGAGGCTTTAGG - Intronic
1024511938 7:50211654-50211676 GAGGGATGGCCTCAGGAGGCAGG + Intergenic
1027750704 7:82141462-82141484 GTGGGATGGGAACAGGAGACTGG - Intronic
1028420670 7:90629251-90629273 GTGGGGTGGCATCAGACTTGAGG - Intronic
1029425066 7:100489687-100489709 GGGGGCTGGCATCAGGGGTGGGG + Intronic
1032245264 7:130205934-130205956 GTGGGAGGCCAGCAGGCGTTTGG - Intronic
1034837678 7:154367309-154367331 GTGTGATGGCAACAGGCGCTAGG + Intronic
1035657431 8:1320467-1320489 CTGGGAAGGCATCAGGAGCCGGG + Intergenic
1035968383 8:4220427-4220449 ATGGGATGGCATTAGAGGTCAGG + Intronic
1036921379 8:12858601-12858623 GAGGGATGGCATGAGGCCACTGG + Intergenic
1037945976 8:22989860-22989882 GAGGGTTCTCATCAGGCGTCTGG - Intronic
1039985453 8:42443936-42443958 GTAGGATGCCTTCAGCCGTCAGG + Intronic
1040387393 8:46922758-46922780 GTGGCCTGGCATCTGGGGTCTGG - Intergenic
1049149057 8:141022643-141022665 GTGGCATGGCATCAGGCCGATGG + Intergenic
1050345325 9:4680033-4680055 GTGGGATGGCATCAGGCGTCAGG - Intronic
1056947699 9:91013825-91013847 GGGGGCTGGCATCAGGAGTCTGG + Intergenic
1057215174 9:93223979-93224001 ATGGGAGGGCATCAGGTCTCTGG - Intronic
1060972876 9:127748839-127748861 GAGGGGTGGCATCAGGTGGCGGG + Intronic
1061631806 9:131876737-131876759 GTGGGCTGGCGACAGGCTTCAGG - Intronic
1061678050 9:132229442-132229464 GTGGGAAGGCATCGGGAGTGAGG - Intronic
1186077147 X:5892951-5892973 GTGGGATGTCATCTGGCGACCGG + Exonic
1188870389 X:35364662-35364684 GGGGGATGGGAGCAGGCCTCAGG - Intergenic
1200954630 Y:8931003-8931025 GTGGGTTGGCATCAGGCTTCTGG - Intergenic
1201518190 Y:14841106-14841128 ATGGGATGTCATCCGGCGACCGG - Exonic