ID: 1050345326

View in Genome Browser
Species Human (GRCh38)
Location 9:4680040-4680062
Sequence AAAAGGGGTGGGATGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 574}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050345326_1050345340 6 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345340 9:4680069-4680091 TCTTCGGAGGGCAGACGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 131
1050345326_1050345336 -6 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345336 9:4680057-4680079 CCTTTTATGGCATCTTCGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1050345326_1050345338 2 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345338 9:4680065-4680087 GGCATCTTCGGAGGGCAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 134
1050345326_1050345337 1 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345337 9:4680064-4680086 TGGCATCTTCGGAGGGCAGACGG 0: 1
1: 0
2: 0
3: 19
4: 171
1050345326_1050345331 -10 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345331 9:4680053-4680075 CACCCCTTTTATGGCATCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 102
1050345326_1050345334 -7 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345326_1050345339 3 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345339 9:4680066-4680088 GCATCTTCGGAGGGCAGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050345326 Original CRISPR AAAAGGGGTGGGATGGCATC AGG (reversed) Intronic
901949487 1:12730745-12730767 ACAAGGGGAGGGATAGCATTAGG - Intergenic
902438231 1:16411827-16411849 ATCAGGGGTGGGGTGGTATCAGG - Intronic
903509355 1:23862815-23862837 AGAGGGGGTGGTTTGGCATCGGG - Intronic
905135735 1:35798300-35798322 GAAAGGGGAGGGATAGCATTAGG - Intergenic
906015144 1:42569987-42570009 ACAAGGGGAGGGATAGCATTAGG + Intronic
906604766 1:47160119-47160141 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
906842679 1:49157214-49157236 ACAAGGGGAGGGATAGCATTAGG - Intronic
907559177 1:55372856-55372878 AAAAGTCCTGGGATTGCATCTGG + Intergenic
907882474 1:58564103-58564125 AATAGGGGAGGGATAGCATTAGG + Intergenic
907907586 1:58798343-58798365 GAGAGGGGAGGGATGGCATCAGG + Intergenic
907949552 1:59168985-59169007 GAAAGGGGAGGGAGAGCATCAGG + Intergenic
907957621 1:59245765-59245787 GCAAGGGGTGGGAGAGCATCGGG - Intergenic
908201501 1:61800710-61800732 AGAAGGGGAGGGATAGCATTAGG - Intronic
908519832 1:64931009-64931031 ACTAGGGGTGGGATGGCATTAGG + Intronic
908893751 1:68875911-68875933 AAGGGGGGAGGGATTGCATCAGG - Intergenic
909340255 1:74523904-74523926 GAAAGGGGAGGGATAGCATTAGG - Intronic
909867714 1:80695156-80695178 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
910145877 1:84078691-84078713 AGCAGGGGTGGGATGGCACTAGG - Intronic
912065196 1:105730028-105730050 GAAGGGGGAGGGATGGCATTGGG + Intergenic
913208013 1:116559133-116559155 GAAAGGAGTTGGATGGCATGGGG + Intronic
913412472 1:118568363-118568385 GAGAGGGGAGGGATGGCATTGGG - Intergenic
913540804 1:119819010-119819032 AAGAGGGGAGGGATAGCATTAGG - Intergenic
915798377 1:158761795-158761817 GAGAGGGGAGGGATAGCATCGGG - Intergenic
915877073 1:159622422-159622444 ACAAGGGGAGGGATAGCATTAGG + Intergenic
916215611 1:162390552-162390574 AGAAGGGGTGGGGTGGTGTCCGG - Intergenic
916441470 1:164829629-164829651 AAGAGGGGAGGGAGAGCATCAGG + Intronic
916612101 1:166402416-166402438 CCAAGGGGAGGGATGGCATTAGG - Intergenic
916620725 1:166493784-166493806 GAGAGGGGAGGGATGGCATTAGG - Intergenic
917047581 1:170878814-170878836 AACAGGGGAGGGATAGCATTAGG + Intergenic
917263784 1:173197685-173197707 GCAAGGGGAGGGAGGGCATCAGG + Intronic
917568018 1:176232034-176232056 ACTAGGGGAGGGATGGCATTAGG - Intergenic
917718832 1:177765393-177765415 AAGGGGGGAGGGATGGCATTGGG + Intergenic
917918280 1:179726515-179726537 AAAAAGGGTAGCATGGAATCTGG - Intergenic
918377686 1:183925345-183925367 AAAAGGGGAGGGAGAGCATTAGG + Intronic
918631452 1:186723976-186723998 AATAGGGGAGGGATAGCATTAGG - Intergenic
918638478 1:186809112-186809134 AAGAGGGGAGGGATAGCATTAGG - Intergenic
919092700 1:192993637-192993659 AAAAGGTGTGGTATGGCCTTCGG - Intergenic
919480053 1:198077285-198077307 AAGGGGGGAGGGATAGCATCGGG - Intergenic
919522970 1:198612175-198612197 GAGGGGGGAGGGATGGCATCGGG - Intergenic
919787318 1:201267797-201267819 AAAAGGGGTGAAATGGCAGAGGG + Intergenic
920076454 1:203340895-203340917 ATCAGGGATGTGATGGCATCTGG + Exonic
921328655 1:214013645-214013667 AACAGGGGATGGCTGGCATCAGG + Intronic
922347636 1:224709529-224709551 AAGAGGGGTGGGCTGGCTTCAGG + Intronic
922447800 1:225712220-225712242 GCAAGGGGAGGGATAGCATCAGG - Intergenic
924803729 1:247346569-247346591 AAAAAGGGTGCAATGGCACCTGG + Intergenic
1063048679 10:2420796-2420818 AAAAGGAGATGGATGGCAGCAGG - Intergenic
1063305740 10:4898189-4898211 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1063514152 10:6677469-6677491 AAATGGGGAGGGATAGCATTAGG + Intergenic
1064041775 10:11972512-11972534 GAGAGGGGAGGGATAGCATCAGG - Intronic
1064793826 10:18989259-18989281 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1064890427 10:20165408-20165430 GAAAGGGGAGGGATAGCATTGGG - Intronic
1064893701 10:20209397-20209419 AAGAGGGGAGGGATAGCATTAGG + Intronic
1064972792 10:21083134-21083156 AAAGGGGCTCTGATGGCATCTGG - Intronic
1065717914 10:28591598-28591620 CAAAGGGCTGGGATTGCAGCAGG - Intronic
1067185301 10:44022054-44022076 AACAAGGATGGGCTGGCATCAGG - Intergenic
1067493535 10:46739821-46739843 AAGAGGAGTTGGATGGCATCTGG - Intergenic
1067601125 10:47600583-47600605 AAGAGGAGTTGGATGGCATCTGG + Intergenic
1067765865 10:49085751-49085773 AAAGGGGGAGGGATGGCATTAGG + Intronic
1067893736 10:50157680-50157702 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1068023275 10:51610902-51610924 GAAAGGGGAGGGAGAGCATCAGG + Intronic
1068027284 10:51662088-51662110 AATAGGGGAGGGATAGCATTAGG + Intronic
1068241585 10:54308763-54308785 AATAGGGGAGGGATAGCATTAGG - Intronic
1068361004 10:55974908-55974930 AAAAGGGTTGGGATGGGTTAGGG - Intergenic
1068946055 10:62729872-62729894 AAAAGGGGAAAAATGGCATCAGG + Intergenic
1069265227 10:66448688-66448710 AAGGGGGGTGGGATAGCATTAGG + Intronic
1070144062 10:73760829-73760851 ACAGGGCTTGGGATGGCATCAGG - Exonic
1070369302 10:75766774-75766796 GAAAGGGGAGGGAGGGCATTAGG - Intronic
1070898298 10:80004930-80004952 ACATGGGGAGGGATAGCATCAGG + Intergenic
1070998948 10:80812675-80812697 AAAAGGGGAGGGACAGCATTAGG - Intergenic
1071652668 10:87408455-87408477 AAGAGGAGTTGGATGGCATCTGG + Intergenic
1072326972 10:94308463-94308485 AAATGGGCAGGGATGGCAACAGG - Intronic
1072365111 10:94701479-94701501 AAAGGGGGAGGGATAGCATTAGG + Intronic
1072911173 10:99502742-99502764 AAAAGGGAGGGTATGGCATCAGG + Intergenic
1073588855 10:104736911-104736933 GAAGGGGGAGGGATGGCATTAGG - Intronic
1074001061 10:109373259-109373281 AAGAGGGGAGGGAAAGCATCAGG + Intergenic
1075185912 10:120256992-120257014 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
1076512720 10:131023877-131023899 AAAAGGGCTGGGCTGGCTTAAGG + Intergenic
1076879176 10:133231500-133231522 AACGGGGGTGGGAAGGCAGCAGG - Exonic
1077708079 11:4507545-4507567 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1077717499 11:4596274-4596296 GAAGGGGGAGGGATGGCATTAGG + Intergenic
1078275794 11:9844751-9844773 ACAAGGGGAGGGATAGCATTAGG + Intronic
1079343348 11:19631236-19631258 AAAGGGGGAGGGATAGCATTGGG - Intronic
1079415266 11:20229134-20229156 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1079671436 11:23176286-23176308 AAAGGGGGAGGGATAGCATTGGG - Intergenic
1079868427 11:25764303-25764325 AATAGGGGAGGGATAGCATTAGG + Intergenic
1080833590 11:35919117-35919139 AAAAGGGGAAGGATGGAAACAGG + Intergenic
1081377321 11:42375435-42375457 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1082885792 11:58080947-58080969 ACAAGGGGAGGGATAGCATTAGG - Intronic
1083019688 11:59494075-59494097 AAGTGGGGAGGGATGGCATTAGG + Intergenic
1083147167 11:60768203-60768225 AAAAAGGGATGGAGGGCATCAGG + Intronic
1083487467 11:62992786-62992808 AATGGGGGTGGGATGGGAGCTGG - Intronic
1083925994 11:65806935-65806957 AAATGGGCTGGGATGGCAATGGG + Intergenic
1084107602 11:66990139-66990161 AAGAGTGCTGGGATTGCATCTGG - Intergenic
1084508954 11:69590504-69590526 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1085819383 11:79775859-79775881 AAAAAGGCTGGGATGGCAGTGGG + Intergenic
1085845752 11:80062530-80062552 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1085993793 11:81885935-81885957 AAAAGGCCTGGGATGGGATTTGG - Intergenic
1086152474 11:83627338-83627360 AAGAGGGGAGGGATAGCATTAGG - Intronic
1086287564 11:85266470-85266492 ACTAGGGGAGGGATAGCATCAGG + Intronic
1086531745 11:87794614-87794636 CAGAGGGGAGGGATAGCATCGGG - Intergenic
1087049070 11:93868107-93868129 AAAAGGGCTGGGCTTTCATCAGG + Intergenic
1087521784 11:99247591-99247613 AAAGGGGGAGGGATAGCATTAGG - Intronic
1087904125 11:103675764-103675786 ACAAGGGGAGGGATAGCATCAGG + Intergenic
1087956834 11:104299104-104299126 ACTAGGGGAGGGATGGCATTAGG - Intergenic
1088214727 11:107495085-107495107 AAAAGAAGTGGGATGGCAGATGG - Intergenic
1088536189 11:110864403-110864425 AAAAGAGGTGGGACAGCATTTGG - Intergenic
1089260511 11:117220895-117220917 AGAAGGGGTTTCATGGCATCTGG - Intronic
1089680589 11:120116928-120116950 AAAAGGGGAGGGATGGAAAATGG + Intronic
1090267346 11:125361691-125361713 AGATGGGGTGGGATAGCATTAGG - Intronic
1090579686 11:128146063-128146085 GAAGGGGGTGGGATAGCATTAGG + Intergenic
1090716939 11:129439408-129439430 GATAGGGGAGGGATGGCATTAGG - Intronic
1091902453 12:4155355-4155377 AAATTGGGAGGGATGGCATATGG + Intergenic
1092940694 12:13404522-13404544 GAACGGGGTGGGATGGTGTCGGG - Intergenic
1092943559 12:13432943-13432965 GCAAGGGGAGGGATGGCATTAGG - Intergenic
1092999170 12:13979663-13979685 AAAAGATGTTGGATGGCATCAGG - Intronic
1094699666 12:32856614-32856636 GAAAGGGGAGGGATAGCATTAGG + Intronic
1095404710 12:41855270-41855292 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1095623658 12:44287867-44287889 AAACTGGGTGGGATGGTATTGGG + Intronic
1096776719 12:53968865-53968887 GAGAGGGGTGGGAAGGCATGGGG - Intergenic
1096883659 12:54694911-54694933 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1097753858 12:63387501-63387523 AAAAGAGGAGGGATAGCTTCAGG + Intergenic
1097822340 12:64141133-64141155 GAGAGGGGAGGGATAGCATCGGG + Intronic
1098110510 12:67117162-67117184 AAGAGGGGAGGGATAGCATCGGG - Intergenic
1099064124 12:77951929-77951951 GAGAGGGGAGGGATAGCATCAGG + Intronic
1099739252 12:86610717-86610739 GAGGGGGGTGGGATGGCATTAGG - Intronic
1099861445 12:88229379-88229401 AAAAGGGCTGGGTTTTCATCAGG - Intergenic
1099878974 12:88442982-88443004 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1100849546 12:98695344-98695366 AAAAGGGGGGGGGCGGCATTGGG - Intronic
1102697506 12:114811536-114811558 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1103053471 12:117800730-117800752 AAAAGGGGAGGGAGAGCATTAGG - Intronic
1103866308 12:124054733-124054755 AAATGGGATGGGTGGGCATCCGG - Intronic
1104859099 12:131915514-131915536 AAAAGGAGTGGGAAGGAAGCTGG + Intronic
1105769819 13:23598246-23598268 ACAAGGGGAGGGATAGCATTAGG + Intronic
1105824388 13:24109089-24109111 AAAAGGAGAGGGATAGCATTAGG - Intronic
1106702855 13:32248393-32248415 ACAAGGGGAGGGATAGCATTAGG + Intronic
1107606648 13:42064060-42064082 AGATGGGGTGGGATGGCGTGAGG + Intronic
1107970295 13:45635300-45635322 AAAAGGGGAGGGATAACATTAGG - Intergenic
1108132407 13:47316782-47316804 AGAAGGGGAGGGATAGCATTAGG + Intergenic
1108262120 13:48668737-48668759 ACAAGGGGAGGGATAGCATTAGG - Intronic
1108480223 13:50861903-50861925 GTAAGGGGTGGGAGAGCATCAGG + Intergenic
1109322393 13:60827326-60827348 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1109359110 13:61272431-61272453 ACTAGGGGAGGGATGGCATTAGG + Intergenic
1109668053 13:65564962-65564984 AAAGGGGGAGGGATAGCATCAGG + Intergenic
1109671493 13:65614322-65614344 GAGAGGGGAGGGATGGCATTAGG - Intergenic
1109884909 13:68529143-68529165 TAAAGGGGAGGGATAGCATTAGG + Intergenic
1110340172 13:74381156-74381178 AAAAAGGGTGGGAGGGGATGAGG - Intergenic
1110768345 13:79305921-79305943 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1110861650 13:80350819-80350841 ACAAGGGGAGGGAGAGCATCAGG - Intergenic
1110972878 13:81788430-81788452 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
1111114725 13:83760113-83760135 CCAAGGGGAGGGATAGCATCAGG + Intergenic
1111296796 13:86289986-86290008 GAAGGGGGAGGGATGGCATTAGG - Intergenic
1112033988 13:95480959-95480981 CAAAGGGGAAGGATGGCAGCTGG - Intronic
1113028094 13:105963357-105963379 GAAAGGGGAGGGAGAGCATCAGG - Intergenic
1113145718 13:107205136-107205158 AAAGGGGGAGGGATAGCATTGGG - Intronic
1113155505 13:107316027-107316049 AAGAGGGGAGGGATAGCATTAGG - Intronic
1113844133 13:113376182-113376204 TAATGGGGTGTGATGGCATCTGG + Intergenic
1114396426 14:22366721-22366743 ACTAGGGGAGGGATGGCATTAGG + Intergenic
1114706650 14:24734229-24734251 AATAGGGGAGGGATAGCATTAGG - Intergenic
1115048014 14:29022240-29022262 GCAAGGGGAGGGATGGCATTAGG - Intergenic
1115364124 14:32537336-32537358 AACTTGGGAGGGATGGCATCTGG - Intronic
1115777233 14:36728931-36728953 AAAAGGAGGGGAATGGCATAGGG + Intronic
1115921777 14:38382288-38382310 ACAGGGGGAGGGAGGGCATCAGG + Intergenic
1116150773 14:41139688-41139710 GAAGGGGGTGGGATAGCATTAGG - Intergenic
1116246783 14:42425889-42425911 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1116308984 14:43296427-43296449 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1116401279 14:44510729-44510751 AAAAGGGGAGGGATAGCATTAGG - Intergenic
1116590503 14:46765331-46765353 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1116718031 14:48453197-48453219 GAGAGGGGAGGGATAGCATCGGG - Intergenic
1116795996 14:49390581-49390603 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
1116971302 14:51068905-51068927 AAGAGGGTTGGGATGGAATGAGG + Intronic
1117105107 14:52390158-52390180 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1117428564 14:55627585-55627607 AATAGGGGAGGGATAGCATTAGG - Intronic
1117576168 14:57100609-57100631 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1118395872 14:65336070-65336092 AATAGGGGAGGGATAGCATTAGG - Intergenic
1118501185 14:66364104-66364126 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
1118564755 14:67127114-67127136 GAAGGGGGAGGGATAGCATCGGG + Intronic
1119629537 14:76215777-76215799 GAGGGGGGAGGGATGGCATCGGG + Intronic
1120630999 14:86889933-86889955 AAAAGGGATGGGATGGTAGGTGG + Intergenic
1120670246 14:87354873-87354895 GAAGGGGGAGGGATAGCATCAGG - Intergenic
1120770658 14:88375893-88375915 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1121416055 14:93779975-93779997 ACGAGGGGTGGGGTGGCATCTGG - Intronic
1122761399 14:104030839-104030861 GAGAGGGGAGGGATAGCATCAGG + Intronic
1124152989 15:27199006-27199028 ACAAGGGGAGGGATAGCATTAGG + Intronic
1124395285 15:29295283-29295305 AAGAGGAGTGGCATGGCCTCAGG + Intronic
1125384791 15:39125929-39125951 GAGAGGGGAGGGATAGCATCAGG - Intergenic
1125857918 15:42968651-42968673 AAAAGGGGAGGGATAGCATTAGG - Intronic
1125889915 15:43258090-43258112 AAGAGGGGAGGGATAGCATTAGG + Intronic
1126089367 15:45037812-45037834 ACAAGGGGAGGGAGGGCATTAGG + Intronic
1126240520 15:46437656-46437678 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1126988421 15:54342013-54342035 AAAAGGAGTAGGATGGGATTGGG - Intronic
1127021660 15:54755269-54755291 GAGAGGGGAGGGATGGCATTAGG + Intergenic
1127572260 15:60255104-60255126 GCAAGGGGTGGGATAGCATTAGG + Intergenic
1129677680 15:77641268-77641290 AACAGGGCTGAGATGGCATGGGG - Intronic
1130161811 15:81409138-81409160 AAGATGGGTGGGATGGCAGAGGG - Intergenic
1130666713 15:85875856-85875878 AAAAGGAGTGGAGTGGTATCTGG - Intergenic
1130711836 15:86290820-86290842 GAAGGGGGAGGGATGGCATTAGG - Intronic
1131739222 15:95369316-95369338 AAAAGGGAGGGGGTGGGATCTGG + Intergenic
1132216468 15:100065851-100065873 AAAAGGGGAGGGAGAGCATTAGG - Intronic
1132283225 15:100638821-100638843 ACAAGGGGAGGGAGGGCATTAGG - Intronic
1136219657 16:28820565-28820587 TAGAGAGGTGGCATGGCATCAGG + Intergenic
1136916156 16:34200497-34200519 AAGGGGGGAGGGATAGCATCGGG - Intergenic
1137360185 16:47807425-47807447 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1137582578 16:49642657-49642679 GGAGGGGGTGGGATGGCAGCAGG - Intronic
1137727198 16:50665044-50665066 AAAAGGTGGGAGATGGGATCTGG + Intergenic
1138313943 16:56052303-56052325 AAGAGGGGAGGGGTGGCCTCAGG - Intergenic
1138705873 16:58914507-58914529 GATAGGGGAGGGATGGCATTAGG - Intergenic
1138855614 16:60687564-60687586 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1138866789 16:60831124-60831146 TAAAGGGGAGGGATAGCATTAGG + Intergenic
1140340004 16:74148552-74148574 GAGAGGGGAGGGATAGCATCGGG - Intergenic
1140605020 16:76526043-76526065 AAAAAGGGTAGCATGGAATCAGG + Intronic
1143367779 17:6419674-6419696 GAAAGGGGTGGGAGAGCATTAGG + Intronic
1148619445 17:49023186-49023208 AAAGGTGGTCTGATGGCATCTGG + Intronic
1148830398 17:50426906-50426928 GCAAGGGGTGGGATGGAAGCTGG + Intronic
1149035665 17:52132021-52132043 AAAGGGGGAGGGATAGCATTAGG + Intronic
1149087451 17:52734989-52735011 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
1149199478 17:54165888-54165910 AAGAGGGGAGGGATAGCATTTGG + Intergenic
1149437824 17:56648914-56648936 CAAAGGGCTGGGCTGGCATCTGG + Intergenic
1149703998 17:58678685-58678707 AAACGGGGAGGGATAGCATTAGG + Intronic
1149721211 17:58846400-58846422 AAACGGGGAGGGATAGCATTAGG - Intronic
1149799502 17:59553935-59553957 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1149945005 17:60915494-60915516 AAAAGGGATGGGGTGGGATGAGG - Intronic
1152682153 17:81674077-81674099 GAAAGGGCTGGGACGGCAGCGGG + Intergenic
1153305188 18:3624465-3624487 AAAAGGGCTGGGCAGGCCTCTGG + Intronic
1153369572 18:4298634-4298656 GAAAGGGGAGGGAAAGCATCGGG + Intronic
1154100960 18:11473313-11473335 ATAAGGGGAGGGATAGCATTAGG - Intergenic
1155763210 18:29591751-29591773 AAAAGGGGAGGGAGAGCATCAGG + Intergenic
1156668410 18:39436998-39437020 AAAAGTGTTGTTATGGCATCAGG - Intergenic
1156674613 18:39512761-39512783 AGAAGGAGAAGGATGGCATCTGG - Intergenic
1157074620 18:44451633-44451655 GAAAGGAGTGGGTGGGCATCAGG - Intergenic
1157931777 18:51831555-51831577 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1158308569 18:56133853-56133875 CTAAGGGGTGGGATAGCATTAGG + Intergenic
1158343056 18:56487227-56487249 CAAAGAGGTGGGATGGAGTCAGG + Intergenic
1158425798 18:57338677-57338699 AAATGGGGTGGGATGAGAGCAGG - Intergenic
1159145660 18:64451302-64451324 GAAGGGGGAGGGATAGCATCAGG - Intergenic
1159428390 18:68319385-68319407 AAAAGGGGAGGGAGGGCATTAGG + Intergenic
1160046148 18:75389361-75389383 CAAAAAGGTGGGATGCCATCGGG - Intergenic
1160114212 18:76062402-76062424 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1160132893 18:76245506-76245528 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1162621403 19:11847356-11847378 AAATGGGGTGCTATGGCAGCTGG - Intergenic
1163170810 19:15529820-15529842 AAAAGGGGTTTGATGTAATCAGG - Exonic
1163218386 19:15897313-15897335 TGAAGGGGTGGGCTGGGATCTGG - Intronic
1163939444 19:20478662-20478684 AAAAGGGCTGGGTTTTCATCAGG + Intergenic
1164346667 19:27271252-27271274 AAAGGGGGAGGGATAGCATTGGG + Intergenic
1164347153 19:27280684-27280706 AAAGGGGGAGGGATAGCATTGGG - Intergenic
1164402542 19:27911702-27911724 CATAGGGGTAGGATGGCACCCGG - Intergenic
1164462705 19:28462590-28462612 AGATGGGGTGGGAAGGCATAGGG + Intergenic
1165313767 19:35042632-35042654 AACAGGGGTGGGGATGCATCTGG - Intronic
1166164084 19:40974470-40974492 GAATGGGGAGGGATAGCATCAGG + Intergenic
1167298397 19:48664777-48664799 AAATGGGGTGGGGGCGCATCAGG + Intronic
1168075509 19:53978994-53979016 AAAAGGGGTGGGGTGGGGTGGGG + Intronic
1168539757 19:57200342-57200364 CAAAGCGCTGGGATGGCATTTGG - Intronic
925180412 2:1813703-1813725 AAAAGGGGTGGGATGGTTTCTGG - Intronic
925301307 2:2814775-2814797 AGAAGGGGTGGGATGACATAGGG + Intergenic
925832501 2:7910107-7910129 AAAATGGGTGGGATGGCTAAGGG - Intergenic
926586364 2:14690008-14690030 AAGAGGGGAGGGATAGCATTAGG + Intergenic
926905012 2:17797262-17797284 AAAGGGGGAGGGATAGCATTAGG + Intronic
927914920 2:26929552-26929574 AAATGGGGAGGGATGGTTTCAGG - Intronic
928496166 2:31834510-31834532 ACAAGGGGAGGGATAGCATTAGG - Intergenic
929361355 2:41095013-41095035 ACGAGGGGAGGGATGGCATTAGG + Intergenic
930390060 2:50749412-50749434 AAAGGGCGTGGGATGCCAACAGG - Intronic
931156673 2:59639602-59639624 AAGAGGGGAGGGATAGCATTAGG + Intergenic
932140407 2:69272444-69272466 AAAGTGGGGGGGAAGGCATCAGG + Intergenic
932413155 2:71559055-71559077 AAAAGGGCTGAGATGGAATGAGG - Intronic
934593628 2:95582565-95582587 AAGTGGGGAGGGATGGCATTAGG + Intergenic
935878759 2:107539930-107539952 AAAGGGGGATGGAGGGCATCTGG + Intergenic
936224652 2:110637176-110637198 AAATGGGGTGTGATTGCCTCTGG + Intergenic
937063507 2:118998789-118998811 AAGGGGGGAGGGATAGCATCGGG - Intergenic
937367688 2:121276196-121276218 ACAAGGGGAGGGATAGCATTAGG - Intronic
937599030 2:123706363-123706385 GAAGGGGGAGGGATAGCATCGGG + Intergenic
937682727 2:124661981-124662003 ACAAGGGGAGGGATAGCATTAGG - Intronic
939132955 2:138259404-138259426 AAGAGGGGAGGGATAGCATTAGG + Intergenic
939526724 2:143304465-143304487 AAGAGGGGAGGGATAGCATTAGG + Intronic
939964480 2:148596944-148596966 ACTAGGGGAGGGATGGCATTAGG + Intergenic
940029950 2:149251437-149251459 ACAAGGGGAGGGATAGCATTAGG - Intergenic
940132288 2:150396064-150396086 AAACGGAATGTGATGGCATCTGG - Intergenic
940180299 2:150924273-150924295 AACAGGGTTGGGATGTGATCTGG - Intergenic
940184079 2:150963068-150963090 ACAAGGGGAGGGATAGCATTAGG + Intergenic
941042514 2:160638575-160638597 AAGAGTGGTTGGATGGCATCTGG - Intergenic
941134346 2:161696042-161696064 AAGTGGGGTGGGATAGCATTAGG - Intronic
941246503 2:163104785-163104807 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
941707661 2:168677149-168677171 AGAAGGGGAGGGATAGCGTCAGG - Intronic
941721355 2:168816449-168816471 AAATGGGGTGGGATTGCAAGTGG - Intronic
942203935 2:173600650-173600672 AAAAGGGGAGGGACAGCATTAGG - Intergenic
942411608 2:175715126-175715148 AGAAGGGGAGGGATAGCATTAGG + Intergenic
942567811 2:177284067-177284089 AAAAGGGTTGGTCTGGCACCTGG + Intronic
942598839 2:177619256-177619278 AAAAGGAGCGGGATGGCAAAAGG + Intergenic
942662988 2:178285930-178285952 GAAAGGGCGGGAATGGCATCAGG - Intronic
942816021 2:180054982-180055004 ACTAGGGGAGGGATAGCATCAGG + Intergenic
943273684 2:185841494-185841516 AATAGGGGAGGGATAGCATTAGG - Intergenic
943979039 2:194523367-194523389 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
945386436 2:209207348-209207370 TAAAGGGGAGGGAGAGCATCAGG + Intergenic
945741915 2:213674514-213674536 AAAGGGGGAGGGATAGCATTGGG - Intronic
947086623 2:226460067-226460089 GTAAGGGGTGGGATAGCATTAGG + Intergenic
947329880 2:229017171-229017193 AATTGGGGTGAGGTGGCATCAGG - Intronic
947976751 2:234373276-234373298 ACCAGAGGTGGGGTGGCATCAGG + Intergenic
948021903 2:234740379-234740401 GCAAGGGGAGGGATAGCATCAGG + Intergenic
948237893 2:236403997-236404019 CACAGTGGTGGGATGGGATCTGG - Intronic
948302052 2:236914829-236914851 AAAATGGGGGGGATGACATGAGG + Intergenic
1169940618 20:10933330-10933352 TAAAGGGGAGGGATAGCATTAGG + Intergenic
1170088397 20:12562640-12562662 ACTAGGGGAGGGATAGCATCAGG + Intergenic
1170490737 20:16871411-16871433 GCAGGGGGTGGGAGGGCATCAGG - Intergenic
1171570644 20:26247410-26247432 GAGAGGGGAGGGATAGCATCGGG + Intergenic
1171913664 20:30991315-30991337 GAGGGGGGAGGGATGGCATCGGG + Intergenic
1172578870 20:36031014-36031036 AGAAGGGCTGGGAAGGCAACGGG + Intergenic
1172703410 20:36865693-36865715 AAACAGGGTGGCATGGCATGTGG + Intergenic
1172793664 20:37522944-37522966 AAAGGGGTTGGGAAGGGATCTGG - Exonic
1173698631 20:45046165-45046187 CAAAGGGCTGGGATTGCACCTGG - Intronic
1173908654 20:46647601-46647623 AAAAGGAGTGGGATGAGCTCTGG - Intronic
1176314631 21:5231257-5231279 AAAAGGGGGGGGATGGGGTGGGG - Intergenic
1176316374 21:5248463-5248485 AAGAGGGCTGGGATAGCATTAGG - Intergenic
1177170762 21:17653148-17653170 GAAAGGGGAGGGATAGCATTAGG + Intergenic
1178118273 21:29440060-29440082 AAGAGGGGAGGGATAGCATTAGG - Intronic
1178209209 21:30508741-30508763 GAAAGGGGAGGGATAGCATTAGG + Intergenic
1179467516 21:41586573-41586595 AAAAGTGGTGGGATGGGATGAGG - Intergenic
1180042377 21:45287298-45287320 AGGAGGGGTGGGATGGGATGGGG - Intronic
1180669131 22:17539523-17539545 AAGAGGGGAGGGATAGCATTAGG + Intronic
1181976929 22:26736792-26736814 ATATGGGGTGGGATGGGATGGGG - Intergenic
1183079670 22:35448395-35448417 AAGAGGGGAGGGATGGCAGTGGG - Intergenic
1183920441 22:41163077-41163099 AAAATGGATGGGATGGTATTTGG + Intronic
1184740636 22:46426960-46426982 GAATGGGCTGGGACGGCATCAGG + Intronic
1185087688 22:48749565-48749587 AAGTGGGGTGGGAAGGCCTCTGG + Intronic
949862151 3:8515655-8515677 AAAGGGAGTGGGATGGAATCGGG + Intronic
949877247 3:8634374-8634396 TAAGGGGGTGGCATGGCCTCAGG - Intronic
950191558 3:10980210-10980232 GAAAGGGGTGGGAAGGGAACAGG + Intergenic
950550439 3:13662949-13662971 AAGTGGGGAGGGATGGCATTAGG - Intergenic
950682083 3:14592432-14592454 AAAGAGGGTGGGAGGCCATCAGG + Intergenic
950934879 3:16828717-16828739 AAAGATGGTGGGATGGCATGTGG + Intronic
951715808 3:25644691-25644713 ACACGGGGTGGGGGGGCATCAGG + Intronic
951750758 3:26033788-26033810 AAGAGGGGAGGGATAGCATTAGG - Intergenic
951905168 3:27699125-27699147 AAAAGTAGTGGGAAGGCATAAGG - Intergenic
954272741 3:49522457-49522479 AAAAGGGGTGGGAGGGGGGCGGG - Intronic
955023299 3:55142199-55142221 AAGGGGGGAGGGATAGCATCGGG + Intergenic
955069809 3:55562673-55562695 AAAAGGGATGGGAGGGCAATTGG - Intronic
957545557 3:81631938-81631960 ACAAGGGGAGGGATAGCATTTGG - Intronic
957598382 3:82299608-82299630 GAGAGGGGAGGGATGGCATTGGG - Intergenic
957869036 3:86064185-86064207 AAGAGGGGAGGGATAGCATTAGG - Intronic
958030328 3:88100821-88100843 AAGCGGGGAGGGATAGCATCAGG + Intronic
958066930 3:88555848-88555870 GAAGGGGGAGGGATGGCATTAGG - Intergenic
958102972 3:89036965-89036987 GAAAGGGGAGGGATAGCATTAGG + Intergenic
958259910 3:91368286-91368308 ACAAGGGGTGGAATGGATTCTGG - Intergenic
958620303 3:96550119-96550141 ACAAGGGGAGGGATAGCATTAGG + Intergenic
959617449 3:108364123-108364145 TAAAGGGGAGGGAGGGCATCAGG - Intronic
959801584 3:110501361-110501383 TAAAGGGGAGGGATAGCATTAGG + Intergenic
959969755 3:112396374-112396396 AAAAGTAGTGGCATGGCATAAGG + Intergenic
961185788 3:124914090-124914112 AAAATGGGTTGGAAGGCATTAGG + Intronic
962358704 3:134716997-134717019 AAAAGGGGAGGCATGACACCTGG - Intronic
962396403 3:135018490-135018512 AGAAGGGGTGGGATTGCAGTGGG - Intronic
963498736 3:146098062-146098084 GAAAGGGGAGGGAGGGCATTAGG + Intronic
963585834 3:147186796-147186818 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
963585846 3:147186913-147186935 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
964368608 3:155975403-155975425 ATAAGGGGAGGGAGAGCATCAGG - Intergenic
964476577 3:157102985-157103007 ACAAGGGGAGGGAGGGCATTAGG + Intergenic
965091959 3:164175742-164175764 ACAAGGGGAGGGATAGCATTAGG + Intergenic
965225462 3:165982863-165982885 GAGAGGGGAGGGATGGCATTAGG + Intergenic
965822536 3:172699216-172699238 TAAAAGGGTGGGAGGGCATCTGG + Intronic
969183653 4:5460245-5460267 CAGAGGGGTGGCATGACATCAGG - Intronic
969871015 4:10104917-10104939 ATGAGGGGTGGGGTGGCAGCAGG - Intronic
970808410 4:20062848-20062870 GAAAGGGGAGGGAGAGCATCAGG - Intergenic
970979401 4:22079042-22079064 AGAAGGGGAGGGATAGCATTAGG - Intergenic
972101218 4:35419344-35419366 ATAAGGGGAGGGATAGCATTAGG + Intergenic
972220766 4:36951458-36951480 ATAAGGGGAGGGAGAGCATCAGG - Intergenic
972888827 4:43528159-43528181 GAAGGGGGAGGGATAGCATCAGG + Intergenic
973572698 4:52256538-52256560 AAAAGCAGTGGGAAGGCTTCTGG + Intergenic
973743436 4:53940292-53940314 GATAGGGGAGGGATGGCATTAGG + Intronic
973860671 4:55061638-55061660 GAAGGGGGAGGGATAGCATCGGG + Intergenic
974116219 4:57582403-57582425 AAGTGGGGAGGGATAGCATCGGG - Intergenic
974750483 4:66134025-66134047 AAGAGGGGAGGGATAGCATTAGG + Intergenic
974946020 4:68529782-68529804 ACTAGGGGAGGGATAGCATCAGG + Intergenic
974983471 4:68990682-68990704 AAAGGGGGAGGGATAGCATTAGG - Intergenic
975212401 4:71716593-71716615 GCAAGGGGTGGGAGGGCATTAGG - Intergenic
975308277 4:72873857-72873879 GCAAGGGGTGGGATAGCATTAGG + Intergenic
975792649 4:77971192-77971214 AAAGGGGGAGGGACAGCATCAGG + Intergenic
976099205 4:81542651-81542673 ATAAGGGGAGGGATAGCATTAGG - Intronic
976120666 4:81777710-81777732 GAAAGGGGAGGGAGAGCATCAGG - Intronic
977426103 4:96868866-96868888 GCAAGGGGAGGGATAGCATCAGG + Intergenic
978743420 4:112164459-112164481 AAGAGGGGAGGGATAGCATTAGG + Intronic
978899608 4:113931036-113931058 GAAAGGGGAGGGATAGCATTGGG + Intronic
979418948 4:120479348-120479370 AAGAGGGGAGGGATAGCATTAGG + Intergenic
979827330 4:125255791-125255813 AATGGGGGAGGGATGGCATTAGG - Intergenic
980317094 4:131216542-131216564 ACAAGGGGAGGGATAGCATTAGG - Intergenic
980494017 4:133568902-133568924 ACAAGGGGAGGGATAGCATTAGG - Intergenic
980638432 4:135539810-135539832 AGTAGGGGTGGGATAGCATTAGG - Intergenic
981262545 4:142738470-142738492 AAGAGGGGAGGGATAGCATTAGG + Intronic
981278746 4:142932474-142932496 AAGAGGGGAGGGATAGCATTAGG + Intergenic
981309744 4:143285626-143285648 AAGAGGGGAGGGATAGCATTAGG - Intergenic
981442944 4:144804038-144804060 AAGAGGGGAGGGATAGCATTAGG - Intergenic
981443947 4:144813024-144813046 GAAAGGGGAGGGATAGCATTAGG + Intergenic
983355066 4:166646396-166646418 AGAGGGGGAGGGAAGGCATCAGG - Intergenic
983518888 4:168686355-168686377 ACAAGGGGAGGGATAGCATTAGG - Intronic
983668853 4:170213117-170213139 AAAGGGGGAGGGATAGCATTAGG + Intergenic
983681144 4:170354915-170354937 AAAGGGGGAGGGATAGCATTAGG - Intergenic
983958343 4:173722932-173722954 GAAAGGGGAGGGATAGCATTGGG - Intergenic
984341013 4:178455920-178455942 AAGAGGGGAGGGATAGCATTAGG - Intergenic
984538212 4:181003228-181003250 CAAAGGGGAGGGATAGCATTAGG + Intergenic
986263241 5:6167374-6167396 AATAGGGGAGGGAAGGCAGCAGG - Intergenic
986437027 5:7744232-7744254 AAAAGGGGAGGGATAGCATTAGG + Intronic
987250190 5:16092594-16092616 AAAAGGGGAGGGAGAGCATTAGG + Intronic
987625317 5:20390995-20391017 AAGAGGGGAGGGATAGCATTTGG + Intronic
987905577 5:24072043-24072065 GAGAGGGGAGGGATAGCATCAGG - Intronic
988058459 5:26133533-26133555 ACAAGGGGAGGGAGGGTATCAGG - Intergenic
988290358 5:29276292-29276314 ACAAGGGGAGGGATAGCATTAGG + Intergenic
988507336 5:31834745-31834767 GAAGGGGGAGGGATGGCATTGGG + Intronic
988699144 5:33655788-33655810 GAAAGGGGAGGGATAGCATTCGG - Intronic
988817354 5:34847558-34847580 AGAAGTGCTGGGATGACATCTGG + Intronic
989320174 5:40125207-40125229 ACAAGGGGAGGGATAGCATTAGG - Intergenic
989325014 5:40182028-40182050 ACAAGGGGAGGGATAGCATTAGG + Intergenic
989493520 5:42084156-42084178 AAAGGGGGAGGGATAGCATTGGG + Intergenic
989676195 5:43975992-43976014 ACAAGGGGAGGGAGAGCATCAGG - Intergenic
989687154 5:44103770-44103792 GAAAGGGGAGGGATAGCATTAGG - Intergenic
989729083 5:44626101-44626123 AAGAGGGGAGGGATAGCATTAGG + Intergenic
990059333 5:51628254-51628276 AAAAGGGGAGAGATGGAAGCAGG - Intergenic
990304039 5:54477538-54477560 AAAGGGGGAGGGATAGCATTAGG + Intergenic
990858337 5:60296952-60296974 GCAAGGGGAGGGATGGCATTAGG + Intronic
991279665 5:64897602-64897624 ATAAGGGGAGGGATAGCATTAGG + Intronic
992476458 5:77107031-77107053 GAGAGGGGTGGGATAGCATTAGG - Intergenic
992565280 5:77990173-77990195 GCAGAGGGTGGGATGGCATCTGG - Intergenic
993270136 5:85786337-85786359 ACAAGGGGAGGGATAGCATTAGG - Intergenic
993315200 5:86395266-86395288 AAAGGGGGAGGGATAGCATTAGG + Intergenic
994015605 5:94961283-94961305 ACAAGGGGAGGGATAGCATTAGG + Intronic
994317493 5:98348997-98349019 GAAGGGGGTGGGATAGCATTAGG + Intergenic
994437522 5:99758022-99758044 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
994479210 5:100311487-100311509 AATAGGGGAGGGATAGCATTAGG + Intergenic
994952863 5:106487419-106487441 AAAAGGGGAGGGAGAGCATTAGG - Intergenic
995027739 5:107443721-107443743 AAAAGGGGAGGGAGAGCATTAGG + Intronic
995109625 5:108414468-108414490 AAAGGGAGGGGGATGGGATCAGG - Intergenic
995337477 5:111016977-111016999 ACAAGGGGTGGGAGAGCATTTGG - Intergenic
995491472 5:112696645-112696667 ACAAGAGATGGAATGGCATCAGG + Intergenic
995645803 5:114309906-114309928 AATAGAGGTGGAATGGCAACAGG + Intergenic
996189493 5:120521801-120521823 AAAGGGGGAGGGATAGCATTAGG - Intronic
996299499 5:121964325-121964347 AAAGGGGGAGGGATAGCATTAGG - Intronic
996997931 5:129721736-129721758 AGAAGGGGAGGGAGAGCATCAGG - Intronic
997056197 5:130447877-130447899 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
997117728 5:131143891-131143913 GCAAGGGGAGGGATGGCATTAGG + Intergenic
997750147 5:136336639-136336661 AAAGGGGGAGGGATAGCATTAGG - Intronic
998510635 5:142711289-142711311 CACAGGGGTGGGAAGGCCTCAGG + Intergenic
998732501 5:145096513-145096535 GAAAGAGGTGGGATCGCATTAGG - Intergenic
998954319 5:147422863-147422885 GAAAGGGGAGGGATAGCATTAGG + Intronic
999501807 5:152154437-152154459 ACAAGGGGAGGGATAGCATTAGG - Intergenic
999866754 5:155709033-155709055 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1000194430 5:158944198-158944220 ACAAGGGGAGGGATGGCATTAGG - Intronic
1000215050 5:159147154-159147176 AACAGGGGTGGGAGGTCTTCGGG + Intergenic
1002524966 5:179810248-179810270 AAGAGGGGAGGGATAGCATTAGG - Intronic
1202774615 5_GL000208v1_random:57573-57595 GAAGGGGGAGGGATAGCATCGGG - Intergenic
1005620208 6:27613295-27613317 AAAAAGGGTGAGGAGGCATCTGG - Intergenic
1006063912 6:31447379-31447401 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1006720967 6:36150697-36150719 AAAATAGGTGGGATGGGATATGG + Intergenic
1006825197 6:36929615-36929637 AAAAGGGGTGGGGTAACATGGGG - Intergenic
1006896389 6:37473941-37473963 ACAGGGGATGGGATGGCATGGGG - Intronic
1007043636 6:38749385-38749407 GAAAGGGGAGGGAGAGCATCAGG + Intronic
1007333734 6:41136091-41136113 GGAAGGGGTGGGATGGCAAACGG + Intergenic
1007979051 6:46131289-46131311 GAAGGGGGAGGGATGGCATTGGG - Intronic
1008311823 6:49985672-49985694 GCAAGGGGAGGGATAGCATCAGG - Intergenic
1008368663 6:50710071-50710093 AAAAGGGGAGGGAGGGCAAAAGG + Intergenic
1008491456 6:52091072-52091094 AAGGGGGGTGGGATAGCATTAGG - Intergenic
1008995327 6:57652089-57652111 ACAAGGGGTGGAATGGATTCTGG + Intergenic
1009192998 6:60652066-60652088 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1009272855 6:61637163-61637185 GACAGGGGTGGGATAGCATTGGG - Intergenic
1009372266 6:62920509-62920531 AAAATCAGTGTGATGGCATCAGG - Intergenic
1009426629 6:63521094-63521116 AAAAGGGGAGGGAGAGCATGCGG + Intergenic
1009507117 6:64498603-64498625 GAAAGGGGAGGGAGGGCATTAGG - Intronic
1010093553 6:72012341-72012363 AAAGAGGGTGGGATAGCATTAGG + Intronic
1010448171 6:75972396-75972418 AAAAGGGTTGGGATGGGTTATGG - Intronic
1010517156 6:76786954-76786976 GGAAGGGGAGGGATGGCATTAGG + Intergenic
1010624119 6:78114804-78114826 ACAAGGGGAGGGAGAGCATCAGG + Intergenic
1010876352 6:81112188-81112210 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1011650301 6:89500032-89500054 AACTGGGGTGTGATGGAATCTGG - Intronic
1011876784 6:91971827-91971849 GAAGGGGGTGGGATAGCATTAGG - Intergenic
1011938043 6:92806105-92806127 AAAAGGTGAGGTATGGTATCAGG + Intergenic
1013673141 6:112427413-112427435 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1013708868 6:112873611-112873633 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
1013886128 6:114970517-114970539 GAGAGGGGAGGGATAGCATCGGG - Intergenic
1014298068 6:119644638-119644660 AAAAGAGCTGGGATTTCATCAGG - Intergenic
1014412837 6:121148115-121148137 GCAAGGGGTGGGATAGCATTAGG - Intronic
1015903147 6:138088105-138088127 AAATTGGGTGGGGTGGCATTTGG + Intergenic
1016558477 6:145367690-145367712 AATAGGGGTGGGGTGGGATGGGG + Intergenic
1017065321 6:150523603-150523625 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1017369751 6:153691173-153691195 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1020615500 7:10454587-10454609 AAAGGGGGTGGAATGGGATGGGG - Intergenic
1021048725 7:15955972-15955994 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1021694364 7:23261936-23261958 AAAAGGGTGGTGATGGCATGGGG - Intronic
1025715032 7:63947607-63947629 AAAAGGGGAGGGAAAGCATTAGG + Intergenic
1026524142 7:71140031-71140053 AAAAAGAGAGGGATGGCATTTGG + Intronic
1027583477 7:80026562-80026584 AAAAGGGGAGGGAAAGCATTAGG + Intergenic
1027675105 7:81147258-81147280 GAAAGGGGAGGGATAGCATTGGG + Intergenic
1027944626 7:84728903-84728925 GTAAGGGGAGGGATAGCATCAGG + Intergenic
1028346337 7:89788728-89788750 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1028373055 7:90116250-90116272 AAGGGGGGAGGGATAGCATCAGG + Intergenic
1028680755 7:93528407-93528429 AAGAGGGGAGGGATAGCATTAGG - Intronic
1028956404 7:96698394-96698416 GCAAGGGGAGGGATGGCATTAGG - Intronic
1029802393 7:102962843-102962865 GAAGGGGGAGGGATAGCATCGGG + Intronic
1030500000 7:110348416-110348438 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1030774222 7:113513804-113513826 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1030778546 7:113567605-113567627 AATAGGGGAGGGATAGCATTAGG + Intergenic
1030973500 7:116090976-116090998 GCAAGGGGAGGGATAGCATCAGG + Intronic
1032654788 7:133916092-133916114 AAAGGGGATGGGATGGTTTCAGG + Intronic
1032926622 7:136613412-136613434 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1033348793 7:140545293-140545315 AAATGGAGTGGGATGGTGTCAGG - Intronic
1034240346 7:149605947-149605969 TGAAGGGGAGGGATGGCTTCAGG - Intergenic
1034315051 7:150123095-150123117 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1034791842 7:153977687-153977709 ACAAGGGGAGGGATAGCATTAGG - Intronic
1036117831 8:5979320-5979342 CAAAGGGGAGGGAGTGCATCAGG - Intergenic
1037596091 8:20355344-20355366 GCAAGGGGTGGGATAGCATTAGG - Intergenic
1037726154 8:21484148-21484170 GTAAGGGGTGGGCTGGCATGTGG - Intergenic
1038111430 8:24503887-24503909 ACAAGGGGAGGGATAGCATTAGG + Intronic
1038506306 8:28088061-28088083 AATAGGTGTGGGATGTAATCTGG + Intergenic
1038656281 8:29455200-29455222 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1038841232 8:31186546-31186568 AAAAGGCGTGGAATGGCATGCGG + Intergenic
1040357523 8:46633846-46633868 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1041682987 8:60612108-60612130 AAAAGGGGAGGGAGAGCATTAGG - Intronic
1042407227 8:68419839-68419861 AAGGGGGGAGGGATGGCATTGGG + Intronic
1042630864 8:70814303-70814325 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1042764861 8:72309855-72309877 AATGGGGGTGGGGTAGCATCAGG - Intergenic
1043225377 8:77721428-77721450 GCAAGGGGTGGGATAGCATTAGG - Intergenic
1043234946 8:77852958-77852980 AAAAGGGGAGGGAGGGAATTAGG - Intergenic
1043330959 8:79117926-79117948 AACAGGGGAGGGATAGCATCAGG + Intergenic
1043338243 8:79203935-79203957 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1043936814 8:86152055-86152077 AATAGGGGAGGGATAGCATTAGG - Intronic
1044062398 8:87654052-87654074 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1044268400 8:90210173-90210195 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1045473989 8:102537803-102537825 CATAGGGTTGGGATGGCATTTGG - Intronic
1046047408 8:108980756-108980778 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1046054830 8:109067041-109067063 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1046406492 8:113779633-113779655 GAAGGGGGAGGGATAGCATCGGG - Intergenic
1046895981 8:119473995-119474017 GAGAGGGGAGGGATGGCATTGGG - Intergenic
1047736910 8:127773757-127773779 ACAAGGGGAGGGAGGGCATTAGG + Intergenic
1047744644 8:127835457-127835479 GCAAGGGGAGGGATGGCATTAGG + Intergenic
1048098907 8:131325431-131325453 GAGAGGGGTGGGATAGCATTAGG + Intergenic
1048209770 8:132445148-132445170 AAAAGGGGTGGACTGACATTTGG + Intronic
1048573874 8:135676118-135676140 ACTAGGGGTGGGATGGTATCTGG + Intergenic
1048937384 8:139368236-139368258 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1049217818 8:141415782-141415804 AGAGGGGATGGGATGGCATGGGG + Intronic
1049614016 8:143568519-143568541 CATAGGGGTGGGATGGTGTCGGG + Intronic
1050345326 9:4680040-4680062 AAAAGGGGTGGGATGGCATCAGG - Intronic
1050861002 9:10430816-10430838 AAAAGGGGTATGATGGCTTATGG - Intronic
1051422439 9:16902287-16902309 AAGAGGGGAGGGATGGCATTAGG - Intergenic
1051614171 9:18991577-18991599 AAAGGGGGAGGGATAGCATTAGG + Intronic
1051695151 9:19760497-19760519 ACAAGGGGAGGGATAGCATTAGG - Intronic
1051846746 9:21459611-21459633 AATGGGGGAGGGATGGCATTAGG + Intergenic
1052290783 9:26837616-26837638 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1052499980 9:29276198-29276220 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1052838336 9:33268577-33268599 AAAAGGAGGAAGATGGCATCTGG - Intronic
1052995608 9:34550321-34550343 AGAAAGTGTGTGATGGCATCAGG + Intergenic
1053049700 9:34949859-34949881 GAAAGGGGTGGGAGAGCATTAGG + Intergenic
1053635187 9:39990980-39991002 GAAAGGGGAGGGAGAGCATCAGG + Intergenic
1054208700 9:62259718-62259740 GAAAGGGGAGGGAGAGCATCAGG - Intergenic
1054549476 9:66385155-66385177 GAAAGGGGAGGGAGAGCATCAGG - Intergenic
1054973920 9:71120897-71120919 AAAAGGGGTGGGGGAGCACCAGG + Intronic
1055062023 9:72078823-72078845 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1055616735 9:78080977-78080999 AAAGGGGGAGGGATAGCATTAGG + Intergenic
1055631516 9:78229170-78229192 AAAAATGGTGGGAGGGCGTCAGG - Intergenic
1055847114 9:80579246-80579268 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1056124291 9:83520004-83520026 AAAAGGGGAAGGATAGCATTAGG + Intronic
1056207770 9:84336756-84336778 AAAGGGGGCAGGCTGGCATCAGG - Intronic
1056493693 9:87134203-87134225 AAAAGGGGAGGGAGAGCATTAGG + Intergenic
1058467465 9:105244268-105244290 AAAAGGGGCCGGATTGCTTCCGG - Intergenic
1058513424 9:105744716-105744738 AAATGGGGAGGGATAGCATTAGG - Intronic
1058827430 9:108787569-108787591 AAAAGGGGCTGGCTGGCATGGGG + Intergenic
1059070377 9:111129743-111129765 TCAAGGGGTGGGATAGCATTAGG - Intergenic
1059492825 9:114683305-114683327 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1059558626 9:115308911-115308933 GAAGGGGGAGGGATAGCATCGGG - Intronic
1059591719 9:115669500-115669522 AATGGGGGTGGGATGGCATTGGG - Intergenic
1059608050 9:115858020-115858042 ATAAGGGGCGGGATAGCATTAGG - Intergenic
1060422340 9:123478137-123478159 AAGAGGGTTGGGACTGCATCTGG + Intronic
1060737645 9:126076631-126076653 AAAAGGGTTGGGATGGCTCAGGG + Intergenic
1203373666 Un_KI270442v1:343964-343986 AACAGGGGAGGGATAGCATTGGG - Intergenic
1185717035 X:2351091-2351113 GCAAGGGGAGGGAGGGCATCAGG + Intronic
1186605778 X:11089451-11089473 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1187199052 X:17117404-17117426 AAGAGGGGAGGGATAGCATTAGG - Intronic
1187559306 X:20385869-20385891 AAAAGGGGAGGGATAGCATTAGG + Intergenic
1187638676 X:21262649-21262671 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1187646909 X:21357312-21357334 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1187785518 X:22881130-22881152 GCAAGGGGAGGGATAGCATCAGG + Intergenic
1188046435 X:25430473-25430495 TAAATGGGTGGGATGGCAAAGGG - Intergenic
1188215577 X:27472527-27472549 AAAAGGGGAGGGAGAGCATCAGG - Intergenic
1189534896 X:41925383-41925405 GAGAGGGGTGGGATGGCTTTTGG - Intergenic
1189627375 X:42913223-42913245 AAAAGGGATATGAGGGCATCAGG + Intergenic
1190423108 X:50305516-50305538 AAGAGGGGAGGGATAGCATTAGG + Intronic
1190967736 X:55317963-55317985 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1191188135 X:57635266-57635288 GAAGGGGGAGGGATAGCATCGGG + Intergenic
1191610696 X:63108915-63108937 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1192000965 X:67151050-67151072 GAAGGGGGAGGGATAGCATCAGG - Intergenic
1192666529 X:73094064-73094086 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1192713994 X:73619837-73619859 AAAAGGGGAGGGATAGCATTAGG - Intronic
1192946297 X:75967988-75968010 AAAAGGGCTGGGTTTTCATCAGG + Intergenic
1193018176 X:76759392-76759414 AAGAGGGGAGGGATAGCATTAGG + Intergenic
1193056291 X:77154728-77154750 ACAAGGGGAGGGAGAGCATCAGG + Intergenic
1193225165 X:78974088-78974110 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1193358778 X:80555696-80555718 AAAAGGAGTGGGACGCTATCAGG + Intergenic
1193516236 X:82468403-82468425 AATAGGGGAGGGATAGCATTAGG - Intergenic
1194575799 X:95613083-95613105 GAAAGGGGAGGGATAGCATTAGG - Intergenic
1194631843 X:96294786-96294808 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1194642976 X:96425727-96425749 CAAAGGGGAGGGATAGCATTAGG - Intergenic
1194826778 X:98574946-98574968 AAATGGGGAGGGATAGCATTAGG - Intergenic
1195355385 X:104034724-104034746 ACAAGGGGAGGGAGAGCATCAGG - Intergenic
1195848689 X:109258107-109258129 AAAGGGAGTGGGAGGGCATGGGG - Intergenic
1196758361 X:119177792-119177814 AAAGGGGGAGGGATAGCATTAGG - Intergenic
1196941303 X:120778698-120778720 ACAGGGGGAGGGAGGGCATCAGG + Intergenic
1197058235 X:122146034-122146056 AAGGGGGGTGGGATAGCATTAGG + Intergenic
1197192511 X:123663750-123663772 GAGAGGGGAGGGATAGCATCAGG - Intronic
1197409944 X:126104255-126104277 AAAGGGGGAGGGATAGCATTGGG - Intergenic
1197430714 X:126359444-126359466 ACAAGGGGAGGGATAGCATTAGG + Intergenic
1198441215 X:136665058-136665080 AAAAGGGGTAGGAATGCATGTGG + Intergenic
1198477347 X:137008466-137008488 CAAAGGGGCGGGATAGCATTAGG + Intergenic
1198623720 X:138544168-138544190 GAGAGGGGAGGGATAGCATCAGG - Intergenic
1198711800 X:139511920-139511942 GAGAGGGGAGGGATAGCATCAGG + Intergenic
1198988563 X:142483721-142483743 AAGAGGGGAGGGATAGCATTGGG + Intergenic
1199175878 X:144786754-144786776 ACAAGGGGAGGGATAGCATTAGG - Intergenic
1200062537 X:153489982-153490004 AGATGGGGTGGGATAGCACCTGG - Intronic
1200838137 Y:7753037-7753059 AAGAGGGGAGGGATAGCATTAGG - Intergenic
1201491308 Y:14544910-14544932 GAAGGGGGAGGGATAGCATCGGG - Intronic
1201666835 Y:16467274-16467296 AAGAGGGGAGGGATAGCATTAGG - Intergenic