ID: 1050345334

View in Genome Browser
Species Human (GRCh38)
Location 9:4680056-4680078
Sequence CCCTTTTATGGCATCTTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050345325_1050345334 0 Left 1050345325 9:4680033-4680055 CCTGACGCCTGATGCCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345324_1050345334 7 Left 1050345324 9:4680026-4680048 CCTGGGACCTGACGCCTGATGCC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345319_1050345334 29 Left 1050345319 9:4680004-4680026 CCTCACTGCCAGGGGCCGGGGAC 0: 1
1: 0
2: 4
3: 58
4: 372
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345323_1050345334 14 Left 1050345323 9:4680019-4680041 CCGGGGACCTGGGACCTGACGCC 0: 1
1: 0
2: 3
3: 22
4: 264
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345322_1050345334 21 Left 1050345322 9:4680012-4680034 CCAGGGGCCGGGGACCTGGGACC 0: 1
1: 0
2: 6
3: 62
4: 488
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1050345326_1050345334 -7 Left 1050345326 9:4680040-4680062 CCTGATGCCATCCCACCCCTTTT 0: 1
1: 0
2: 1
3: 35
4: 574
Right 1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050345334 Original CRISPR CCCTTTTATGGCATCTTCGG AGG Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
907904252 1:58769848-58769870 CCCTTTGAAGACTTCTTCGGTGG - Intergenic
908655683 1:66385766-66385788 CCCTTTTATGGAGACTTCAGTGG - Intergenic
912470731 1:109905008-109905030 CCCTTTAATGACATCTGAGGTGG + Intergenic
917334268 1:173912365-173912387 CACTTTTGTGGCATCTACTGGGG + Intronic
918902291 1:190438791-190438813 CACTATTATGGCATCTTGAGAGG - Intronic
921294692 1:213690856-213690878 CCCTTTTATAGCTCCTTCAGTGG - Intergenic
922219740 1:223549459-223549481 CCCTTGGATGGTATCTTTGGAGG - Intronic
1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG + Intronic
1077515256 11:2997690-2997712 CCCTTAGCTGGCATCTTTGGGGG + Intergenic
1084504128 11:69554466-69554488 CCTTTTTATTGCATCTTCTCGGG - Intergenic
1086345639 11:85893090-85893112 CCCTTCTCTGGCAGCTTGGGTGG - Intronic
1089833667 11:121351052-121351074 CCCTTTTGTGGCATTTTTGTAGG - Intergenic
1090708866 11:129367359-129367381 CTCTTCTATGGCGTCTTCGATGG - Intergenic
1091935027 12:4428218-4428240 CCCTTTCATGCCATCTCTGGGGG - Intronic
1093910994 12:24747445-24747467 CATTTTTATGACATCTTTGGAGG + Intergenic
1097984422 12:65768474-65768496 CCTTCATATGGCATCTTCTGGGG - Intergenic
1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG + Intergenic
1107306955 13:39032448-39032470 CCCTTTTGGAGCATCTTTGGAGG - Intronic
1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG + Intergenic
1119806840 14:77487747-77487769 CCCTCTTCTGGCATCTCCTGGGG - Intronic
1142143734 16:88483940-88483962 TCCTTCTCTCGCATCTTCGGGGG + Intronic
1144209276 17:13000993-13001015 CCCTTTGTTGGCATCTGCGCAGG - Intronic
1144329482 17:14211363-14211385 ACCTTTTATGGCATGGTGGGAGG + Intergenic
1149493222 17:57099930-57099952 CCCCCTTATGGGATCTTGGGAGG + Intronic
1153922867 18:9806599-9806621 CCATTCTGTGGCATCTTGGGTGG - Intronic
1160768107 19:817596-817618 CCTTGTTATGGCATCTTAGCAGG + Intronic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1168246642 19:55115950-55115972 CCCTGTCATGGCATCTTCCAGGG - Intronic
925452172 2:3979009-3979031 CCCCTTTGTGGTATCTTCTGCGG + Intergenic
926831026 2:16962057-16962079 CCCTTTTATCTCATCTTTGGTGG - Intergenic
932454469 2:71838869-71838891 CACTTTTATGCCACCTTCTGGGG - Intergenic
933099263 2:78230990-78231012 CCCTTTTATGTCATCTGCTAGGG - Intergenic
935481052 2:103590477-103590499 ACCTTTTATGCCATCTTTGAAGG - Intergenic
1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG + Intergenic
1174597410 20:51695123-51695145 CCCTTATCTGGCATGATCGGAGG - Intronic
1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG + Intronic
1182246372 22:28961138-28961160 CCCTTTTGTGCCATCTTGGAAGG - Intronic
1182690968 22:32162302-32162324 CCCTTTTATGGTCTCTTTTGTGG - Intergenic
957245795 3:77714212-77714234 GCCTTTTATGTCATCTACGTTGG + Intergenic
958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG + Intergenic
961284478 3:125790089-125790111 CCCTTTGATGCCCACTTCGGTGG - Intergenic
971605134 4:28649557-28649579 CCCTTGTAAGGCATGTTTGGTGG + Intergenic
971708778 4:30084670-30084692 TCCTTTTATGCCAACTTGGGTGG + Intergenic
972652637 4:41033748-41033770 CCCTTTTATGTCATCTGTGGTGG - Intronic
977679279 4:99781124-99781146 CCCTTTAATGGCATATTCTGAGG - Intergenic
985234757 4:187860941-187860963 CTCTTTTAGGGCATGCTCGGTGG + Intergenic
986293683 5:6420195-6420217 GCCTTTTCTGGCATCTTCAGAGG - Intergenic
994119317 5:96096133-96096155 TCCTTTTAGGGCAGCTTCAGAGG - Intergenic
997721273 5:136079934-136079956 CCCTTGTATGGCTTCTAGGGGGG + Intergenic
1013135416 6:107277595-107277617 CCCTTTTGTTGCATCTTCCTTGG - Intronic
1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG + Intergenic
1019309433 7:353057-353079 CCCATTTATGGGGTCTTCAGGGG + Intergenic
1021236879 7:18153333-18153355 CCCTGTTATGGAATTTTCTGGGG + Intronic
1025932520 7:66007710-66007732 CGCTTTTTTTGCATCTTCGATGG + Intergenic
1029912030 7:104163344-104163366 CCCTTTAGTGGCAACTTCAGAGG + Intronic
1033411034 7:141117982-141118004 CCATTCTATGGCATCTGTGGTGG + Intronic
1033852831 7:145517948-145517970 AACTTTTAAAGCATCTTCGGTGG + Intergenic
1037593049 8:20329464-20329486 CCCTTCTTTGTCATCGTCGGAGG + Intergenic
1037700283 8:21267586-21267608 CCTTTTTATGCCATCTTGGCTGG - Intergenic
1047154542 8:122302260-122302282 CCATTTTATCACATCTTCAGAGG + Intergenic
1047492798 8:125388376-125388398 CTCTTTGTTGGCTTCTTCGGGGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050612039 9:7362872-7362894 GCATTTTATGGCATGTTTGGAGG - Intergenic
1062411424 9:136427103-136427125 CGCTTTTATGGCTTCTTCCTAGG - Intergenic
1201934420 Y:19392217-19392239 CCCTTTTATGACAACTTTGCTGG + Intergenic