ID: 1050346227

View in Genome Browser
Species Human (GRCh38)
Location 9:4690935-4690957
Sequence CACTCTCCACTGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050346227_1050346231 -3 Left 1050346227 9:4690935-4690957 CCAAGTTCCATCAGTGGAGAGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1050346231 9:4690955-4690977 GTGGACCAACTTGTAGTCATGGG No data
1050346227_1050346232 -2 Left 1050346227 9:4690935-4690957 CCAAGTTCCATCAGTGGAGAGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1050346232 9:4690956-4690978 TGGACCAACTTGTAGTCATGGGG No data
1050346227_1050346230 -4 Left 1050346227 9:4690935-4690957 CCAAGTTCCATCAGTGGAGAGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1050346230 9:4690954-4690976 AGTGGACCAACTTGTAGTCATGG No data
1050346227_1050346234 23 Left 1050346227 9:4690935-4690957 CCAAGTTCCATCAGTGGAGAGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1050346234 9:4690981-4691003 TGATGAGATAATAATCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050346227 Original CRISPR CACTCTCCACTGATGGAACT TGG (reversed) Intronic
902198605 1:14817009-14817031 CAATGGCCACTGTTGGAACTTGG - Intronic
904490655 1:30857040-30857062 CACTCCCCAGTGGTGGAAGTAGG + Intergenic
906156956 1:43619525-43619547 CACTCTCCCCTGGAGGCACTTGG - Exonic
907623446 1:56005920-56005942 CTCTTTCCACTGATGGAAGGAGG + Intergenic
908824756 1:68122746-68122768 CTCTTTCCACTGATTGAAATGGG + Intronic
923317629 1:232796557-232796579 CAATCTCCATTAATGCAACTAGG + Intergenic
924642523 1:245848013-245848035 CACACTCCACTCCTGGGACTAGG - Intronic
924866835 1:247991968-247991990 CACTCACCACTGCTGTCACTTGG - Intronic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1064535118 10:16350338-16350360 CTCTGTCCACTGAGGCAACTAGG + Intergenic
1064905532 10:20341775-20341797 CACTTTCCACTGTTGCAGCTGGG + Intergenic
1065035815 10:21637793-21637815 CACTACACACTGATGGTACTTGG - Intronic
1067066318 10:43106026-43106048 CACTCTCCCCTGAGGAAGCTGGG - Intronic
1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG + Intronic
1068163867 10:53303080-53303102 CACTTTCCTCCCATGGAACTGGG - Intergenic
1068892362 10:62160982-62161004 CACTCTCCACAGATGGACAGTGG - Intergenic
1069109851 10:64433738-64433760 AACTGTCCTCTGTTGGAACTAGG + Intergenic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1071205514 10:83271673-83271695 GTCTCTCCAGTGATGAAACTTGG - Intergenic
1073002222 10:100294278-100294300 CATTCTCCAAGGATGGAAATGGG - Intronic
1073178956 10:101572575-101572597 CACTCCCTACTGCTGTAACTGGG - Intronic
1076032814 10:127173988-127174010 GCCTCTCCACTGCTGGAGCTGGG + Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1078765466 11:14292766-14292788 AAATGTCCACTGATGAAACTTGG - Intronic
1081288406 11:41301723-41301745 CTCTCTCCTCTGATGAAATTGGG - Intronic
1083417220 11:62533576-62533598 AAATGTCCACTGCTGGAACTTGG + Exonic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1099461100 12:82922144-82922166 CACACTTCACTGAAAGAACTTGG + Intronic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1110315487 13:74101523-74101545 CACTCTCCACTGAAGGAACCAGG + Intronic
1110994457 13:82087996-82088018 CAATCCCCAGTGTTGGAACTGGG - Intergenic
1113140134 13:107138374-107138396 TACTCTCCTCTGAAGGAACCAGG - Intergenic
1120093966 14:80366676-80366698 CATTCTCCAACAATGGAACTGGG + Intronic
1120413636 14:84192460-84192482 CATTCTCCACTGATACAACATGG - Intergenic
1120799489 14:88672816-88672838 CACTCTCCAAAGACGGAACCAGG + Intronic
1124581886 15:30963217-30963239 CACCGTCCAGTGATGGAAGTAGG - Intronic
1124791659 15:32732718-32732740 CACTGTCCTCTGATTAAACTTGG + Exonic
1124806303 15:32886791-32886813 CCCTCTCCACTGGTAGAATTAGG - Intronic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128569372 15:68722688-68722710 CCCTCTCAACAGATGTAACTGGG + Intronic
1131077899 15:89509692-89509714 TAGTTGCCACTGATGGAACTGGG + Intergenic
1134647514 16:15881974-15881996 CACTCCCCAGTGTTGGAAGTGGG + Intronic
1138295755 16:55883816-55883838 CACTCCCAACTGATGCACCTGGG + Intronic
1138528446 16:57621937-57621959 CCCTCTCCACTGGGGGAATTTGG + Intronic
1140548633 16:75838010-75838032 CACTCAGCACTGATGAAACTTGG - Intergenic
1142157425 16:88539000-88539022 CACTGTCCACTCATGGCACACGG + Intergenic
1144667124 17:17109619-17109641 CCCTCTCCGCTAATGGAACAAGG - Intronic
1145370100 17:22300676-22300698 CTCTCTTCACTGGTGGAAGTCGG + Intergenic
1146376756 17:32299720-32299742 CACTCTGCACTGGTGTCACTGGG - Intronic
1147377937 17:40033845-40033867 CACTCTCCTCTGGGGGAACTGGG + Intronic
1150698161 17:67423814-67423836 AACTCTCCACTGTGGGACCTGGG - Intronic
1157201087 18:45660395-45660417 CACATTCCTCTGATGGAACTAGG - Intronic
1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG + Intergenic
1160146268 18:76367544-76367566 CACATTCCACTGGAGGAACTGGG - Intronic
1163525037 19:17815691-17815713 GACTCTCCCCTGATGGCAATAGG - Intergenic
1167297452 19:48660017-48660039 CACACTCCTATGATGTAACTGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925269136 2:2589973-2589995 CCCTCTCCACCTATGGAACTAGG - Intergenic
926999108 2:18773703-18773725 CACTGTCTAGTGATGTAACTTGG - Intergenic
927256667 2:21045426-21045448 GAGTCTCCTCTGAGGGAACTGGG - Intergenic
930175281 2:48295078-48295100 CCCACTCCACTGGTGGAACAAGG - Intergenic
935127424 2:100236681-100236703 CACTCTCCATGGATGGTTCTTGG - Intergenic
935446067 2:103158189-103158211 AACTTTCCACTGCTGGAACAGGG + Intergenic
938232359 2:129672212-129672234 CAATATCCAATGATGGAACAGGG - Intergenic
940757240 2:157697556-157697578 CACTCTTCCTTGATGGAGCTGGG + Intergenic
941718577 2:168789049-168789071 CATTCTCCACTAAAGGAACCAGG + Intronic
943199186 2:184797205-184797227 AATACTCCACTGATGGCACTAGG - Intronic
944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1176104899 20:63381317-63381339 CTTTCTCCTCTGATGGAAGTCGG - Intergenic
1178749712 21:35289776-35289798 CACTCTCTGCTGATGAGACTTGG - Intronic
1179570466 21:42275631-42275653 CATTCTCCACAGATGCGACTAGG + Intronic
1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG + Intronic
1180598066 22:16992305-16992327 CACTCTCCACCTTTGAAACTGGG - Intronic
950682094 3:14592487-14592509 CACACTCCACTGAAGAAACCGGG + Intergenic
952221268 3:31326558-31326580 CAGTCTCCAATGTTGGAAGTGGG - Intergenic
954451619 3:50574789-50574811 CACTCTCTCCTGCTGGAACTGGG + Intronic
954678350 3:52327701-52327723 CCCTCTCCACTGCTAGGACTGGG - Intronic
954847284 3:53570975-53570997 CACCCTCCTCTGGGGGAACTAGG + Intronic
967189572 3:186973803-186973825 CACTCTTCGCTGACTGAACTTGG - Intronic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
969480266 4:7443221-7443243 CACCCTCCACTGATGGATTCTGG + Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
975506670 4:75145661-75145683 TACTCTCCAGTGTTGGAATTGGG - Intergenic
978169517 4:105652367-105652389 TTCTCTCCACTGATGGATTTCGG - Intronic
982220947 4:153124804-153124826 CTCTCTACACTAATGAAACTGGG + Intergenic
983070060 4:163257226-163257248 CACTCTTCTCTGATGGAAGTAGG + Intergenic
992552670 5:77874118-77874140 CCCACTGCACTGATGGAAATGGG - Intergenic
999179237 5:149657247-149657269 CACTTTCCCTTAATGGAACTGGG - Intergenic
1000285139 5:159820197-159820219 CACTTTCCACTGAGGTCACTTGG + Intergenic
1001308752 5:170595338-170595360 ATCCCACCACTGATGGAACTGGG - Intronic
1001590543 5:172861476-172861498 CAGGCTCCATTGATGGCACTGGG - Intronic
1001612189 5:173011857-173011879 CACTCTGAATTGATGGAAGTGGG - Intronic
1002699129 5:181110101-181110123 CATTCTCCACTGATGGACACTGG - Intergenic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1010987457 6:82441042-82441064 CAATCTCCACTGAAGGCTCTAGG - Intergenic
1011366856 6:86591883-86591905 CACTGTCCACTCATGGCACAGGG - Intergenic
1013769196 6:113608491-113608513 CACCAGCCACTGATGGTACTTGG - Intergenic
1014897631 6:126922658-126922680 CACTTCCCACTGATGGGGCTGGG - Intergenic
1016569121 6:145492810-145492832 CTCTCTCTGCTGATGGAGCTGGG + Intergenic
1016904810 6:149137991-149138013 CAATCCCCACTGATGAAATTAGG - Intergenic
1017280605 6:152620269-152620291 CACTCAACACTGAGGGAAGTGGG - Intronic
1019200285 6:170308181-170308203 CACTCACTAATGATGGAGCTGGG - Intronic
1019217700 6:170454284-170454306 CAGTCCCCACTGAGGGCACTCGG + Intergenic
1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG + Intronic
1019855825 7:3606372-3606394 CACTCAACCCTGATGCAACTGGG - Intronic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1022990489 7:35702544-35702566 CACTGGGCACTGCTGGAACTGGG - Intergenic
1024962994 7:54996998-54997020 CACTCACCACTCCTGGAGCTGGG - Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1028658709 7:93241299-93241321 CACTGGTCACTGATGGAGCTAGG - Intronic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1030628991 7:111874342-111874364 CATTCTCCACTGCTGCCACTTGG - Intronic
1031751994 7:125586562-125586584 CATTCTCCACTAATGGACCTAGG - Intergenic
1033668930 7:143471305-143471327 AACTATCCACTGATGAAAATAGG + Intergenic
1033673839 7:143518677-143518699 GACTCCCCACTGATGAGACTGGG - Intergenic
1036764224 8:11536886-11536908 CACTCTGAACTGATGGAATCGGG + Intronic
1040488443 8:47896715-47896737 CACTCTCCACACATGGCACAGGG + Intronic
1041224958 8:55688937-55688959 CACTCACCACTGATGTGAGTGGG - Intergenic
1044142159 8:88669846-88669868 CACTCTCCATGGACAGAACTAGG - Intergenic
1045900293 8:107270565-107270587 CCCTTTCCACTGAAAGAACTGGG + Intronic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1059317314 9:113437093-113437115 CAACCTCCACTGGTGGAAATAGG - Intergenic
1059881561 9:118695950-118695972 CAATCTCCAATGCTGGAAGTGGG - Intergenic
1185689167 X:2139149-2139171 CAATCCTCACTGATGGCACTAGG - Intergenic
1187207495 X:17197049-17197071 CTCTCTCCACTGCTGTTACTTGG - Intergenic
1193411063 X:81163570-81163592 AACTCACTACTGCTGGAACTGGG + Intronic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1195865477 X:109428236-109428258 TACTCTCCAGTGGAGGAACTTGG + Intronic
1198000617 X:132431608-132431630 CATTCTCCAATAAAGGAACTCGG - Intronic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic