ID: 1050348008

View in Genome Browser
Species Human (GRCh38)
Location 9:4712154-4712176
Sequence CAGGTTAAGAAATGTGTTTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 2, 2: 5, 3: 35, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050348008 Original CRISPR CAGGTTAAGAAATGTGTTTT AGG (reversed) Exonic
904504633 1:30940689-30940711 CAGGTTGTGAAAGGTGTCTTAGG - Intronic
904508126 1:30976282-30976304 CTGGTTAGCAAATGTGTCTTTGG - Intronic
904790919 1:33020518-33020540 GAGGTTAAGAAATGTGCCTAGGG + Intronic
905742601 1:40385448-40385470 CAGATTAAGAAATTTCTTTTTGG - Intronic
905959556 1:42032487-42032509 CTTCTTAAGAAATCTGTTTTTGG + Intronic
908710856 1:67012404-67012426 TAGGTTTAGAAATGTGTTCTTGG - Intronic
908840957 1:68279712-68279734 CAGGAAAACAAATGTTTTTTAGG + Intergenic
910243127 1:85109854-85109876 TGGGTTTAGAAATGTGGTTTAGG + Intronic
910413665 1:86973943-86973965 CAGAGTAAGAAATATATTTTTGG + Intronic
911395074 1:97295590-97295612 CAGGCTAAGTTTTGTGTTTTTGG + Intronic
914719288 1:150276243-150276265 TAGGTTAACAAATCTGTTTTGGG - Intronic
915847343 1:159280377-159280399 GAGGTTGAAAAATTTGTTTTAGG - Intergenic
915849077 1:159301843-159301865 GAGGTTAAGTAACTTGTTTTGGG - Intronic
916813834 1:168331224-168331246 GAGGTTAAGAAACTTGTTTAAGG + Intergenic
917696433 1:177529431-177529453 CAGTTTAACAAGTGTGTATTTGG - Intergenic
918470224 1:184864543-184864565 GAGGTGAAGAAATGTTGTTTGGG + Intronic
918525110 1:185456432-185456454 CAGGTTAAGTCATATTTTTTTGG - Intergenic
919428825 1:197468146-197468168 GAGGTAAAGAAGTATGTTTTAGG - Intronic
920759570 1:208769401-208769423 CAGGCTGAGATATATGTTTTGGG + Intergenic
920818019 1:209353634-209353656 GAGGTTAACAAATGTGCTCTAGG + Intergenic
921807097 1:219467564-219467586 CAGGCACTGAAATGTGTTTTGGG - Intergenic
922351486 1:224737726-224737748 GAGGTTAAGAAATGTGTCTCAGG + Intronic
923581485 1:235219774-235219796 CTGGGTAAGAAAATTGTTTTTGG - Exonic
924217502 1:241839294-241839316 AAGTGTAAGAAAGGTGTTTTTGG + Intergenic
924287977 1:242508061-242508083 AAGCTAAAGAAATGTGTGTTTGG + Intronic
924578592 1:245303115-245303137 AAAGTAAAGAAATGTGTTTAAGG - Intronic
924767506 1:247047374-247047396 CAAGTTAAGAATTGAGGTTTGGG - Intronic
924767530 1:247047539-247047561 CAAGTTAAGAATTGAGGTTTGGG - Intronic
1063503060 10:6571993-6572015 CAGGTTAAGAAACTTGATCTAGG - Intronic
1064092156 10:12394613-12394635 CAGGGTAAGAAATCTATCTTTGG - Intronic
1064750979 10:18528709-18528731 CAGGTTTAGAAATATATTTGAGG + Intronic
1066179492 10:32946089-32946111 CGGGTTAAGAAATGTGTTTTAGG + Intronic
1066543026 10:36469712-36469734 CAGGTTAAAAATGGTGTTTTGGG + Intergenic
1066790659 10:39059261-39059283 CAGGTTAGAAATAGTGTTTTTGG + Intergenic
1067150602 10:43729521-43729543 CAGGATGAGAAGTGTGATTTCGG - Intergenic
1068058799 10:52040340-52040362 CAGATTATGAAATGTGTTACAGG - Intronic
1069070017 10:63983350-63983372 CAGGTCAAGAATTGAGGTTTGGG + Intergenic
1069112504 10:64464656-64464678 GAAGTTAAGAAATGAGGTTTCGG - Intergenic
1069211034 10:65760520-65760542 CAGGTCAAGAATTGAGGTTTGGG - Intergenic
1070376016 10:75831769-75831791 CAAGTCAAGAAATGAGGTTTGGG - Intronic
1070380673 10:75878020-75878042 CAGGTCATGAAGAGTGTTTTTGG + Intronic
1071768520 10:88697909-88697931 AAGTTTAAGAAATATGTATTAGG + Intergenic
1073142127 10:101255058-101255080 CAGGTCAAGAGATGCGCTTTGGG + Intergenic
1074042888 10:109809945-109809967 AAGGTTAAGAATTGAGGTTTGGG - Intergenic
1074267704 10:111921257-111921279 AAAGTTAAGAAATGTGTCTAAGG + Intergenic
1074415863 10:113266081-113266103 GAGGTTAAGAAATTTGTTTAAGG + Intergenic
1074918670 10:117984418-117984440 CAGGTGAAGAGCTTTGTTTTCGG + Intergenic
1075053954 10:119204499-119204521 CAGGTTAAGAAAGGTTTTATAGG - Intergenic
1075110925 10:119583382-119583404 CATCTTTATAAATGTGTTTTAGG - Intronic
1075646312 10:124099205-124099227 CAGGATCAGATCTGTGTTTTGGG - Intergenic
1076710397 10:132330808-132330830 CACAGTAAGAAATGTTTTTTAGG - Intronic
1079170603 11:18091565-18091587 TAGGTTAAGAAAACTGTTCTAGG - Intronic
1080243394 11:30153046-30153068 CAGGTTAAGAAATATTTCCTAGG - Intergenic
1081394686 11:42572318-42572340 CAGGTGAGGAAATAAGTTTTTGG - Intergenic
1081885640 11:46493588-46493610 CAGGTAAGGAAATGTTTCTTTGG - Exonic
1081925555 11:46825138-46825160 GAGGTTAAGAAATGTTTTCAAGG + Intronic
1083248622 11:61450163-61450185 GAGGTTAAATAATGTGTTTCAGG - Intronic
1085924488 11:80999304-80999326 CATTTTAAGAAATTTGCTTTTGG - Intergenic
1086177039 11:83903052-83903074 CTGGATGAGAAATGTGTTATCGG + Intronic
1086177825 11:83913614-83913636 AAGCCCAAGAAATGTGTTTTTGG - Intronic
1086222784 11:84469855-84469877 CATTCTAAGAAATGTGTGTTAGG + Intronic
1086728528 11:90219995-90220017 CAGTTTACGAAATTTGTGTTGGG - Intronic
1086817759 11:91394313-91394335 CAGGGAAAGCAATGTGTTCTGGG + Intergenic
1087285118 11:96256646-96256668 GAGGTTAGGAACTGTGTTTCTGG + Intronic
1088083488 11:105949469-105949491 GAGGGTAACAACTGTGTTTTAGG - Intronic
1088103754 11:106183025-106183047 CAGGTAAAGAAAGGTTTTTAAGG + Intergenic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1088959228 11:114644759-114644781 CAGATTTAGATATGTATTTTTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090191446 11:124772341-124772363 CAGGAAAACAGATGTGTTTTTGG - Intronic
1090490256 11:127154503-127154525 CAGGTTAAGAAATGCCTCTGTGG - Intergenic
1092623818 12:10303720-10303742 CAGAAAAAGAAATGTGTTGTTGG - Intergenic
1092773225 12:11917564-11917586 GAGCTTAAGATATTTGTTTTGGG - Intergenic
1093395017 12:18670494-18670516 GAGGTTAAGAACTGTGTTGAAGG - Intergenic
1093417711 12:18939465-18939487 CATTTTGAGAACTGTGTTTTGGG + Intergenic
1093791987 12:23262916-23262938 CAGATTAATGGATGTGTTTTTGG + Intergenic
1094437692 12:30439596-30439618 CAGCTTAATAATTCTGTTTTTGG - Intergenic
1094531985 12:31284825-31284847 CATGGTAATTAATGTGTTTTGGG - Intronic
1094739028 12:33267622-33267644 CAGGTTATGAGATGTTTTTCAGG - Intergenic
1095867274 12:46985509-46985531 CAGGATATGAAATTTATTTTTGG - Intergenic
1096915519 12:55027709-55027731 CAGATTATGCAATGAGTTTTTGG - Exonic
1097122957 12:56750050-56750072 CAAGTATAGAAATGGGTTTTAGG + Intronic
1098310883 12:69148011-69148033 CAGGCTAAGAGAGGTGTATTAGG + Intergenic
1098437619 12:70484712-70484734 CAAGGGCAGAAATGTGTTTTGGG - Intergenic
1098782088 12:74700214-74700236 CAGTTTAAGAACTGTGTTAGGGG + Intergenic
1099294940 12:80818433-80818455 AAGGTTAAGAAATGTGTCCTAGG + Intronic
1099371365 12:81835127-81835149 GAAGTTAAGAATTGTGGTTTGGG + Intergenic
1100007058 12:89907120-89907142 CTGGTTAAGAAATATATTTCTGG - Intergenic
1100013237 12:89978522-89978544 CAGGTGAAAAAATGAATTTTGGG + Intergenic
1100023726 12:90102213-90102235 AAGGTTAGGAAAGGTGTTTCTGG - Intergenic
1100119007 12:91346164-91346186 CAGGATAAGATCTGTGTTTGGGG - Intergenic
1100784039 12:98060219-98060241 CAGCTAAAGGAATATGTTTTTGG - Intergenic
1102433036 12:112898423-112898445 AAAGTTAAGAGATGTGATTTGGG - Exonic
1102777020 12:115528934-115528956 GAGGTCCAGAAATGAGTTTTTGG + Intergenic
1103837322 12:123833031-123833053 CAAGCTAAGGAAGGTGTTTTTGG + Intronic
1104459504 12:128943448-128943470 CAGGTTGAGAAATGTGTTTTAGG - Intronic
1105488368 13:20860262-20860284 AAGGTTAAAAAAATTGTTTTTGG - Intronic
1107069366 13:36254117-36254139 CTGTTTAAGTAATGTGTTTAAGG + Exonic
1107515820 13:41128169-41128191 AAGGGAGAGAAATGTGTTTTGGG - Exonic
1107686167 13:42901425-42901447 AGGGTTAAGTAATGTGCTTTAGG - Intronic
1108004857 13:45935994-45936016 AAGGCTGAGAAATGTGATTTTGG - Intergenic
1109379602 13:61542489-61542511 GAAGTTAAGAAATGTGTTTATGG + Intergenic
1109739254 13:66530240-66530262 CAGGAGAAGATATGTGTTTGTGG + Intronic
1110406267 13:75153850-75153872 CTAATTAAGAAATTTGTTTTAGG + Intergenic
1110905341 13:80880410-80880432 AAGGATAAGGAATGGGTTTTGGG + Intergenic
1111085757 13:83373486-83373508 CAGGTTAAGAAATGTCATCTTGG + Intergenic
1111617432 13:90678677-90678699 AGGCTTAAGAAAAGTGTTTTGGG - Intergenic
1113033952 13:106027883-106027905 CAGGTTAGGAAGTATGCTTTTGG + Intergenic
1113136585 13:107097020-107097042 CAGAAGAAGAAATGTCTTTTAGG + Intergenic
1114600507 14:23952452-23952474 TAGGTTTAGAGATGTGTTATTGG - Intergenic
1114604740 14:23987600-23987622 TAGGTTTAGAGATGTGTTATTGG - Intronic
1114624701 14:24121317-24121339 TAGGTTAGGAAATCTGCTTTGGG - Intronic
1115954346 14:38761479-38761501 CATTTTAAAAAATGTGCTTTAGG - Intergenic
1117053301 14:51884477-51884499 GAGGTTAAGTAATGTGCTTAGGG + Intronic
1117709364 14:58508880-58508902 GAGGCTAAGTAATGTGTTCTAGG - Intronic
1119142961 14:72284508-72284530 GAAGTTAAGAATTGAGTTTTGGG + Intronic
1119159417 14:72440760-72440782 CAGGTTAAGAACAGAGTTTTAGG - Intronic
1119590536 14:75883330-75883352 CAGGAAAGGAAATGTCTTTTTGG - Intronic
1120188368 14:81417607-81417629 CAGGATAGGAAATACGTTTTTGG + Intronic
1121112118 14:91319721-91319743 CAGCATAAGAAATGTGTGTCTGG + Intronic
1121394183 14:93604245-93604267 CAGGATAAGAAATAGGTTTTGGG - Intronic
1121396696 14:93630504-93630526 AAGGTTAAGGAATTTGTTTGGGG + Intronic
1121986974 14:98516447-98516469 CCGGTTAAGACATGTTTGTTGGG - Intergenic
1202843058 14_GL000009v2_random:141819-141841 CATCTTAAAAAATATGTTTTAGG - Intergenic
1202912460 14_GL000194v1_random:132070-132092 CATCTTAAAAAATATGTTTTAGG - Intergenic
1202880177 14_KI270722v1_random:50571-50593 CATCTTAAAAAATATGTTTTAGG + Intergenic
1124833353 15:33171907-33171929 GAATTAAAGAAATGTGTTTTTGG + Intronic
1125794837 15:42396538-42396560 AAGGTTAAGAATTGAGTTCTGGG - Intronic
1126260599 15:46685309-46685331 CATGTAAAGACATGTCTTTTGGG - Intergenic
1126325413 15:47471815-47471837 GAGGTTAACAAATGTGTGTCAGG + Intronic
1126419775 15:48459252-48459274 GAGGTTAAAAGATCTGTTTTGGG + Intronic
1126428636 15:48557015-48557037 CAGGTGAAGGAAGGTCTTTTTGG + Intronic
1128275132 15:66347093-66347115 CATGTAAAGGAATGTGATTTAGG - Intronic
1128439576 15:67692517-67692539 CAGGTTAAGCTGTGTGATTTTGG + Exonic
1130068007 15:80621291-80621313 GAGTTTAAGAAATGTTTTTAAGG - Intergenic
1130158875 15:81378786-81378808 GAAGTTTAGAAATATGTTTTGGG + Intergenic
1131112484 15:89774191-89774213 CAGGTTAAGGAGTTGGTTTTGGG - Intronic
1131419558 15:92293518-92293540 CTGCTTAAGGAATGTGCTTTGGG - Intergenic
1132435520 15:101798441-101798463 CAATTTAAGAACTGTGTCTTAGG + Intergenic
1133673044 16:8043090-8043112 CAGGTTAAGAAATGAGCTCCGGG + Intergenic
1133814431 16:9185635-9185657 CAGGTTCAGAAACATGTTTCAGG - Intergenic
1134042109 16:11076661-11076683 CTGGTTCAGAGATTTGTTTTGGG - Intronic
1134301443 16:12994928-12994950 CAGATGAATATATGTGTTTTGGG + Intronic
1134419191 16:14070769-14070791 GAGGTGCAGAAATGGGTTTTGGG + Intergenic
1135734824 16:24922462-24922484 AAGGGGAAAAAATGTGTTTTGGG + Intronic
1136245401 16:28973006-28973028 CATTTTAAAAATTGTGTTTTTGG - Intergenic
1137414369 16:48260294-48260316 CAGGTTAAAAAATAAGTTCTGGG + Intronic
1139605406 16:68014643-68014665 GACCTTAAGAAATGTATTTTTGG - Intronic
1140545328 16:75802508-75802530 CAGATTAAAAAAATTGTTTTAGG + Intergenic
1203142021 16_KI270728v1_random:1772903-1772925 TAGGATAAGAAATCTGTCTTAGG - Intergenic
1143222643 17:5275523-5275545 GAGGTTAAACAATGTGTTTTGGG + Intergenic
1144167494 17:12626560-12626582 CATGTTAATAAATGTGGTTTAGG - Intergenic
1145903610 17:28504568-28504590 CAGTATAAGAATTGTGTTCTGGG - Intronic
1146114278 17:30120747-30120769 CAGGTTAAGTAATTTGTTCAAGG + Intronic
1146191069 17:30766693-30766715 AAGCTTAAGAAATGTGTTGATGG + Intergenic
1146336223 17:31973336-31973358 AAGCTTAAGAAATGTGTTGATGG + Intronic
1148916232 17:50981608-50981630 TAGGGAAAGAAATGTGATTTGGG + Intronic
1149264542 17:54913363-54913385 GAGCTTAAGAATTGTGTTTTCGG + Intronic
1149489187 17:57069835-57069857 CAGGATAGGAAATGTATTCTAGG - Intergenic
1152714088 17:81890085-81890107 CTGGTTAAGAAATGACTTTTTGG - Intronic
1153512148 18:5867474-5867496 CACGTAAACAAATGCGTTTTAGG - Intergenic
1153692203 18:7605214-7605236 AAAGTTAACAAATTTGTTTTGGG + Intronic
1154391757 18:13942834-13942856 CATCTTAAGAAATGTGATTATGG + Intergenic
1155400001 18:25427645-25427667 AAGGTGAAGAAATGTTTTCTAGG - Intergenic
1155777482 18:29785400-29785422 CAGATGAAGAAATCTGCTTTTGG + Intergenic
1156418469 18:36924608-36924630 CAGGATCAGATATGTGCTTTTGG + Intronic
1156697653 18:39786535-39786557 CAGGATAATAACTGTATTTTTGG - Intergenic
1156838531 18:41584313-41584335 CAAGTTTAAAAATGTGTATTGGG + Intergenic
1156853679 18:41756952-41756974 AAGTGTAAGAAATGAGTTTTGGG + Intergenic
1157543888 18:48534245-48534267 CAGGTCAAGGCTTGTGTTTTAGG - Intergenic
1157588282 18:48819135-48819157 TTTGTTAAGAAATGTGGTTTGGG - Intronic
1158147737 18:54335059-54335081 CATCTTAGGAAATCTGTTTTGGG - Intronic
1159077498 18:63698391-63698413 GAGGTTAGGAGTTGTGTTTTAGG - Intronic
1159265513 18:66073757-66073779 GAACTTAAGAAATGAGTTTTGGG - Intergenic
1159641201 18:70864816-70864838 AAGGTGAAGAATTGGGTTTTGGG + Intergenic
1159791722 18:72789750-72789772 GGGATTAAGAAATGTGTTCTAGG - Intronic
1164787835 19:30948913-30948935 CAGGTTTCTCAATGTGTTTTTGG + Intergenic
1165239480 19:34453827-34453849 CAATTTAAGAAAACTGTTTTAGG - Intronic
1165428963 19:35761130-35761152 CAGGGTATGAAATGTGATTTTGG - Intronic
1166635640 19:44449381-44449403 CAGGCTAAGGAATGTCTTTTTGG - Intergenic
1167309806 19:48730460-48730482 CATGTTAAGAAATGGGTCTCTGG - Intronic
1202655788 1_KI270708v1_random:19663-19685 CATCTTAAAAAATATGTTTTAGG + Intergenic
926132120 2:10310083-10310105 CAGGTGCAGAAAGGGGTTTTAGG + Intronic
926663751 2:15497164-15497186 CAGCTTATGTAATGTCTTTTTGG + Intronic
927382427 2:22494424-22494446 CAGTTTAAAAAATGTGTCTGTGG + Intergenic
928297389 2:30096337-30096359 CAGGGAAAGAAAAGTGATTTTGG - Intergenic
928863240 2:35885968-35885990 CAGGTTAAGATACTTGTATTTGG - Intergenic
929210232 2:39348855-39348877 AAGATTAAAAAGTGTGTTTTAGG - Intronic
929320236 2:40534384-40534406 CATGTTATTAAATATGTTTTAGG + Intronic
929399518 2:41563815-41563837 CAGGAAAAGAAATTTGTTTGGGG - Intergenic
929980266 2:46671996-46672018 CAAGCTAAGAAATGTCTTTGTGG + Intergenic
930438479 2:51377147-51377169 GAAGTCAAGAATTGTGTTTTGGG + Intergenic
930544126 2:52745705-52745727 AAAGTTAAGAAATGAGGTTTGGG + Intergenic
931067388 2:58601733-58601755 CATGTTGAGAAAAGTGTTCTAGG - Intergenic
931186543 2:59957562-59957584 CAGGTGCTGAAATGGGTTTTTGG - Intergenic
932728755 2:74202405-74202427 CAGGATTAGGAATGTATTTTTGG + Intronic
934593207 2:95577568-95577590 TAGTTATAGAAATGTGTTTTTGG - Intergenic
935689058 2:105714067-105714089 AATATTAAGAAATGTGTCTTGGG + Intergenic
937821203 2:126313137-126313159 CAGGTTAAGCAAGGTGTTTGGGG + Intergenic
940201325 2:151154160-151154182 CAGAATATGAAGTGTGTTTTCGG + Intergenic
941613214 2:167686949-167686971 CAGATTAAGAAATGTCTCTCTGG - Intergenic
942267907 2:174246867-174246889 TATGTGATGAAATGTGTTTTGGG - Intronic
942364268 2:175206645-175206667 AAGATTAAGAAATGTTTTGTTGG - Intergenic
943192985 2:184704677-184704699 CAGGCTAAGATATTTGCTTTGGG - Intronic
944325368 2:198398045-198398067 CAGTTAAAGAAGTGGGTTTTAGG + Intronic
945517973 2:210786416-210786438 AAGGCAAAGAAATATGTTTTAGG - Intergenic
946198883 2:218058917-218058939 CATGGAAAGAAATGTGTTCTGGG - Intronic
946349417 2:219139637-219139659 CAAGATAATAAATGTGTTTTTGG + Intronic
946754247 2:222927571-222927593 CAGGTTCAGAAATGTTTATGAGG + Intronic
947380636 2:229542039-229542061 TAGGTCAAGAAATTTGTATTTGG - Intronic
948499066 2:238378411-238378433 AAGGTTAACAACTGTCTTTTTGG + Intronic
948953021 2:241267259-241267281 AAGTTTAAGAAATTTGTGTTGGG + Intronic
1169024521 20:2357698-2357720 CAGCTTGGGACATGTGTTTTTGG + Intergenic
1169882828 20:10366109-10366131 CATCATAAGAAATGTGTATTTGG - Intergenic
1170065277 20:12303767-12303789 GAAGTTAAGAAATGGGGTTTGGG - Intergenic
1170225697 20:13989896-13989918 CAATTTAAGAAATATGTATTTGG - Intronic
1170269649 20:14510978-14511000 CAGGTTGGTAAATGTTTTTTTGG + Intronic
1170444700 20:16414089-16414111 CAGATTAAGTAATATGTTCTAGG + Intronic
1170511040 20:17077007-17077029 CAGGTTAAGAAATGTGCCCAAGG + Intergenic
1172202673 20:33137959-33137981 CAGGATAAGAATTCTGTTGTGGG - Intergenic
1172706525 20:36886292-36886314 TAGGTTTAAAAATTTGTTTTAGG + Intronic
1173003091 20:39119552-39119574 AAGGTGAAGAATTGTGATTTGGG - Intergenic
1173155056 20:40601661-40601683 CAGTGTTAGAACTGTGTTTTAGG + Intergenic
1174913483 20:54631671-54631693 CATGTTAAAAAATGTGTAATAGG + Intronic
1174964269 20:55193681-55193703 TAGTTTAAGAAATATATTTTTGG - Intergenic
1175096319 20:56544207-56544229 CAGGTTAAAAAATCTGTGATTGG + Intergenic
1176631818 21:9146743-9146765 CATCTTAAAAAATATGTTTTAGG - Intergenic
1176641487 21:9308106-9308128 CACCTTAAAAAATATGTTTTAGG + Intergenic
1177087060 21:16718899-16718921 GAGGGAAAGAAATCTGTTTTAGG + Intergenic
1177389143 21:20443810-20443832 CAGGTAAAGAAATGTGCGTTTGG + Intergenic
1179000043 21:37449095-37449117 GAAGTTAAGAAATGTGTTTTCGG - Intronic
1180350506 22:11797463-11797485 CACCTTAAAAAATATGTTTTAGG + Intergenic
1180374786 22:12080877-12080899 CATCTTAAAAAATATGTTTTAGG + Intergenic
1180387705 22:12194601-12194623 CACCTTAAAAAATATGTTTTAGG - Intergenic
1181746051 22:24955623-24955645 CAGGGTCAGATGTGTGTTTTGGG + Intronic
1182606794 22:31512040-31512062 CAGGTAAAGAAATAGGTTATTGG + Intronic
1184577262 22:45380615-45380637 ACAGTTAAGAAATATGTTTTTGG + Intronic
949305157 3:2631660-2631682 CAGGTTAACAAATATGCCTTAGG + Intronic
949444585 3:4120317-4120339 CAGATTTTGAAAGGTGTTTTAGG - Intronic
949654159 3:6197869-6197891 GAGGTTTAGGAATGAGTTTTAGG - Intergenic
950643100 3:14360918-14360940 CAGGGTTAGAAATGTGTTCCAGG + Intergenic
951215229 3:20017960-20017982 CAGGAAAAGAAATGTGATTGAGG + Intergenic
952560075 3:34581904-34581926 GAGGTTAAGCAATTTGTCTTAGG + Intergenic
953800722 3:46020706-46020728 GAGTTCAAGAAATGTTTTTTTGG + Exonic
954691122 3:52396231-52396253 CTGGTTAAGAATTGGGCTTTTGG - Intronic
955383682 3:58461535-58461557 CAGGTAAACATAAGTGTTTTCGG + Intergenic
955452890 3:59089211-59089233 AATGATAATAAATGTGTTTTAGG - Intergenic
955810572 3:62783583-62783605 CAGGTTAAGAAAATTGCTTAAGG - Intronic
955820123 3:62887851-62887873 CAGTTTAAGAAATGTTCCTTAGG + Intergenic
956093800 3:65695234-65695256 CAGGATAAAAGATGTATTTTAGG + Intronic
956890825 3:73612641-73612663 CTGGCTGAGAAATGTGTTTTGGG + Intronic
957750817 3:84412942-84412964 CAGGTAAAGAAAGGTTTTTATGG + Intergenic
958653018 3:96962342-96962364 CATGATAAGAATTGTGCTTTAGG + Intronic
958675354 3:97263176-97263198 CTGGTTTATAAATGTGTTTCTGG + Intronic
960543185 3:118882981-118883003 GAGGAAAAGAAATGTGATTTGGG + Intergenic
963082476 3:141407009-141407031 CATAATCAGAAATGTGTTTTGGG - Intronic
963708147 3:148714325-148714347 CAGGTTAAAAAGAGTGTTTAGGG + Intronic
963949437 3:151182737-151182759 CAGGACAAGAAATGTATTTGAGG + Intronic
964169341 3:153750603-153750625 GAGGGTAAAAAATGTTTTTTTGG + Intergenic
964452728 3:156826948-156826970 CATTTTAAAAAATGTCTTTTCGG + Exonic
965065407 3:163841282-163841304 GAAGTTAAGAAATGAGGTTTGGG - Intergenic
967051288 3:185786860-185786882 CTGGATAATAAATGTATTTTAGG + Intronic
967220717 3:187245865-187245887 TAGGTCAAGAAATGTGTGTCTGG - Intronic
968172866 3:196524382-196524404 CAGATTAAAAGATGAGTTTTAGG - Intergenic
968251521 3:197220619-197220641 CAGTTTAAGAAAGGAGTTTTTGG + Intronic
1202745408 3_GL000221v1_random:96913-96935 CACCTTAAAAAATATGTTTTAGG - Intergenic
968755855 4:2416428-2416450 CAGCTGGAGAAATGTGTCTTAGG - Intronic
968954814 4:3712834-3712856 CATGTTGAGACATGTATTTTAGG - Intergenic
969879909 4:10164256-10164278 CAGTTTAGGAGATGTGTTCTAGG - Intergenic
970014127 4:11493626-11493648 GAGGTTAAGTAATGTGTCTAAGG + Intergenic
970276348 4:14405144-14405166 CAGGATAAGAAGTCTGTTATTGG - Intergenic
971680078 4:29687435-29687457 CAGGTTATAAACTTTGTTTTGGG - Intergenic
971726949 4:30326890-30326912 CAGGTTAAGAACTGTTTGCTGGG + Intergenic
971790268 4:31161487-31161509 CAGGTTAAGTAACTTGTCTTGGG - Intergenic
971872019 4:32253374-32253396 CAGGAAAAGAAATGTGGTTTTGG - Intergenic
971982666 4:33773757-33773779 CAAGTAAAGAAATGGATTTTTGG + Intergenic
972814289 4:42627158-42627180 CTAGTTATGAAATCTGTTTTTGG - Intronic
974157298 4:58090859-58090881 CAAGTGAAAAAATGTGTTTATGG - Intergenic
975070440 4:70130814-70130836 CAGGCAAACTAATGTGTTTTTGG - Intergenic
975190763 4:71459130-71459152 GAGGTTAAGTAATGTGTATTTGG + Intronic
975876370 4:78842304-78842326 CAAATTAAGAAATGTCTTTATGG - Intronic
976069543 4:81225258-81225280 CACCTTAGGAAAAGTGTTTTTGG - Intergenic
977302679 4:95285976-95285998 GAGGTTAAGCAATGTGCTTAAGG - Intronic
977403173 4:96561211-96561233 CAGATTAAAGAATTTGTTTTGGG - Intergenic
977802923 4:101259559-101259581 TAGCTTAAAAAATGTGTTTCTGG + Intronic
978631750 4:110755103-110755125 TTTGTTAAGAAATATGTTTTGGG - Intergenic
978683018 4:111405322-111405344 CAGGCTGAGAGATGTGTTTATGG + Intergenic
981616015 4:146645643-146645665 TAAGTTTAGAAATTTGTTTTTGG + Intergenic
981840453 4:149105606-149105628 CAGGTAAAGAAAAGTGTTCTTGG - Intergenic
981969460 4:150649210-150649232 CAGTTTAAGAACTATGTTTCAGG - Intronic
982015475 4:151149172-151149194 CTGGTTAAGAAACTGGTTTTTGG - Intronic
982181777 4:152754601-152754623 GAGGTCAAGAAAAGTATTTTGGG - Intronic
982853887 4:160356143-160356165 CAGGTTAAAAGGTGTGTTGTGGG + Intergenic
983160325 4:164405574-164405596 CAGGTTAAGAAATGAGAATTTGG - Intergenic
983492915 4:168410516-168410538 CAGGATCAGAATTATGTTTTAGG + Intronic
983887763 4:172999584-172999606 CAGGGTAAGAAATGCCTATTTGG - Intronic
983925347 4:173395337-173395359 TAGAATAAAAAATGTGTTTTTGG - Intronic
984749072 4:183254169-183254191 CAGGATAAGTTCTGTGTTTTAGG + Intronic
1202756373 4_GL000008v2_random:66318-66340 CATCTTAAAAAATATGTTTTAGG + Intergenic
985803036 5:2018473-2018495 CAGGCCTAGAAATGTTTTTTGGG + Intergenic
986297857 5:6454553-6454575 CTGGTTAAGAAATGCCTGTTTGG - Intronic
986834010 5:11614291-11614313 CAGGTTAAAAAATGTGCCTGAGG + Intronic
987497487 5:18666434-18666456 CATCTGAAGAAATGTGATTTTGG - Intergenic
987908387 5:24108692-24108714 CATGTTAAGAATAATGTTTTGGG + Intronic
988033394 5:25795813-25795835 CAGGCTCAGAAATGTGATTAAGG - Intergenic
988214116 5:28249106-28249128 AAGGTTGTCAAATGTGTTTTAGG + Intergenic
988790211 5:34601009-34601031 AAGGGTAAGAAAAGTATTTTAGG + Intergenic
989508933 5:42260387-42260409 TAGGTTAAAAAATGTATTTCGGG - Intergenic
991376526 5:65973808-65973830 GGGATTAAGAAATGTTTTTTAGG + Intronic
993248734 5:85487048-85487070 CTGGTTAAGAAAGGTTTTTATGG + Intergenic
994073192 5:95623405-95623427 CAGGTCAGGAAAGGTGTTCTAGG + Intergenic
994290263 5:98021617-98021639 TAGGTTGAGAAATTTGTTTGTGG - Intergenic
995633030 5:114154491-114154513 CAGGCTCAGAAATTTGATTTTGG + Intergenic
996115776 5:119616699-119616721 CAGTTTAAGGCATGTGCTTTAGG + Intronic
996365419 5:122695931-122695953 GAAGTTAAGAAATGAGTTCTAGG - Intergenic
996579690 5:125017755-125017777 GAGGGTAAGAAAGGAGTTTTTGG - Intergenic
997775613 5:136601778-136601800 AAGGTCAAGAAATGAGATTTGGG + Intergenic
998027427 5:138830397-138830419 GAGATTTAGAAATGTATTTTAGG + Intronic
999568982 5:152897360-152897382 AAGGGTAAGAAATGTGTCCTTGG - Intergenic
999837351 5:155388706-155388728 AAACTTAAGAAATGTGCTTTAGG + Intergenic
1000116743 5:158160835-158160857 GAGGTTAAGAAATGTGTGCTAGG + Intergenic
1000141966 5:158413920-158413942 CAGGATAAGAAATATCTTTAAGG + Intergenic
1000206733 5:159067876-159067898 CAGGATAATTATTGTGTTTTTGG - Intronic
1001247677 5:170117366-170117388 CAGGTTAGGACAGGTGTGTTGGG - Intergenic
1001532305 5:172471992-172472014 CAGGTGTAGACATGTGTTTCTGG + Intergenic
1003357417 6:5386739-5386761 CAGGAAGAGAAATGTGTTTTGGG + Intronic
1004177498 6:13352667-13352689 CAGACTAAGAAATGTATCTTTGG + Intergenic
1005139540 6:22612319-22612341 CAAGTTATGAAATGTTTCTTCGG + Intergenic
1006970477 6:38039017-38039039 CAGATTGAGAAATGTGATCTAGG - Intronic
1006982382 6:38156953-38156975 CTGATTAAGAAAAGTTTTTTTGG - Intergenic
1007625109 6:43241906-43241928 CAGGTTAAGTAATATGCATTGGG - Intergenic
1008627010 6:53326661-53326683 CAGGTTAAATAATTTGTATTTGG - Intronic
1008907667 6:56697381-56697403 AATTTTAAAAAATGTGTTTTAGG - Intronic
1009169966 6:60386027-60386049 CAGGTCAAGACATGATTTTTTGG - Intergenic
1009761788 6:68016119-68016141 CAATTTAAGAAATGTGTCCTAGG + Intergenic
1010118629 6:72345915-72345937 CATCATAGGAAATGTGTTTTAGG + Intronic
1011030765 6:82920246-82920268 CAGGCTAACAAATGTGTTTTTGG + Intronic
1011768611 6:90651624-90651646 CAGGTTAAGAAACATGGTTGTGG + Intergenic
1012518022 6:100086355-100086377 GATGTTAAGAAGTGTGTATTAGG + Intergenic
1012555244 6:100503739-100503761 CAAGTAAAGAAATGTGGATTTGG + Intergenic
1014074486 6:117220686-117220708 CAAGGCCAGAAATGTGTTTTGGG + Intergenic
1014162999 6:118191687-118191709 CAGGTAAAGAAAGGTTTTTGTGG - Intronic
1014624322 6:123707445-123707467 AAAGTTAACAAATTTGTTTTAGG + Intergenic
1014758466 6:125328017-125328039 CAGTCTAAGATAAGTGTTTTTGG - Intergenic
1015742610 6:136473216-136473238 AAGGTTAATCAATGTGTTTTTGG - Intronic
1016648737 6:146439766-146439788 CTGGTTTAGCAATGTGGTTTTGG - Intergenic
1016673282 6:146733312-146733334 TAATTTAAGAAATGTGTTTGTGG + Intronic
1017208096 6:151825609-151825631 GAGGGTTAGAAATGTGTTGTTGG + Intronic
1018369793 6:163157103-163157125 TAGGAGAAGAGATGTGTTTTAGG - Intronic
1019034865 6:169046137-169046159 CATGTGAAGAAATGAGTATTTGG + Intergenic
1020647045 7:10827078-10827100 AAGATAATGAAATGTGTTTTTGG + Intergenic
1020670562 7:11103627-11103649 CTGATTAATAAATGTGGTTTTGG + Exonic
1020807440 7:12808135-12808157 CAGGTAAATAGATTTGTTTTAGG + Intergenic
1021462393 7:20902985-20903007 CAGGGAAAGAAATGTGTACTTGG + Intergenic
1021535744 7:21702345-21702367 CAGGTGGAGAAATGTGCTTCTGG + Intronic
1021740049 7:23677869-23677891 GAGGGTTAGAAATGTGTGTTGGG - Intergenic
1022316329 7:29248557-29248579 CACGATCAGAACTGTGTTTTGGG - Intronic
1022756377 7:33296158-33296180 CAGTTTAAGTAATCTATTTTGGG - Intronic
1023501193 7:40851244-40851266 GAGGTTAAGAAATGTGTACAAGG - Intronic
1024709860 7:52003282-52003304 GAAGTTAAGAATTTTGTTTTGGG + Intergenic
1025141955 7:56474169-56474191 AAGGTTAAGAAATTTGACTTAGG - Intergenic
1025535528 7:61943494-61943516 CAGGTTAAAAACTCTCTTTTTGG + Intergenic
1025707858 7:63883720-63883742 CAGGGTAAGAAGTGAGTGTTGGG - Intergenic
1026618746 7:71931847-71931869 AAGTCTAAGAAATGAGTTTTGGG - Intronic
1027572015 7:79881379-79881401 AAAGGTAAGAGATGTGTTTTAGG + Intergenic
1027893030 7:84001746-84001768 GATGTAAAGAAATGTATTTTTGG - Intronic
1028215868 7:88132548-88132570 GATGTTAAGATATGTATTTTTGG + Intronic
1028236323 7:88366516-88366538 AAGGTTAAAAAATTTGTTCTAGG - Intergenic
1028674116 7:93439128-93439150 CAGATTAAGAAATGTGTCTTAGG + Intronic
1029838470 7:103337964-103337986 AAGGTTGAGAAATGTGGATTAGG + Intronic
1031769060 7:125820155-125820177 CAGTTTAAGTAATGTGCTTGTGG + Intergenic
1032183091 7:129698588-129698610 CAGGTTAGTAAATTTCTTTTAGG + Intronic
1032664955 7:134026989-134027011 CAGGTTAAAAAAAATCTTTTTGG - Intronic
1032951167 7:136915119-136915141 CTGGTTAAGAAATGTACTTCAGG + Intronic
1033927929 7:146487024-146487046 TAGGTTTAGAAATGTCATTTTGG - Intronic
1034168340 7:149043019-149043041 CCTGGTCAGAAATGTGTTTTTGG - Intergenic
1034687325 7:152984281-152984303 GAGGTTAAGAAATGTGCCTGAGG + Intergenic
1035323083 7:158046754-158046776 CAGGTTAGGAAATCTGCTTCAGG - Intronic
1036589345 8:10153741-10153763 CACGTTAAGAAATATGTTCGAGG + Intronic
1037090855 8:14916316-14916338 CTGAGTAAGAAATGTGATTTGGG - Intronic
1037092384 8:14937980-14938002 CAGCTTAAGAAATGTTTGATTGG + Intronic
1037517173 8:19644380-19644402 GAGGTTAAGAACTGTTTTTCAGG - Intronic
1037734596 8:21556146-21556168 CAGGTTAAGGAACATGTCTTTGG - Intergenic
1038606730 8:29014171-29014193 CAAGTTATGAAAAGAGTTTTGGG + Intronic
1039041028 8:33409006-33409028 CAGATTAAGCAATATCTTTTAGG + Intronic
1039118135 8:34115254-34115276 GAGATTAAGACTTGTGTTTTAGG + Intergenic
1041359808 8:57041135-57041157 TGGGCAAAGAAATGTGTTTTGGG + Intergenic
1042766991 8:72332729-72332751 GAGGTTAAGTAATTTGTTTAAGG - Intergenic
1042835306 8:73074491-73074513 GAGGTTAAGAAATGTGTTTAAGG + Intronic
1042921699 8:73926553-73926575 AAGATTAAGAAATGTAATTTAGG + Intergenic
1043134157 8:76500413-76500435 CAGGTCCAGAAATGTTGTTTGGG + Intergenic
1044222901 8:89690434-89690456 CAGGTGAGGAAATGTGCTATCGG + Intergenic
1044366289 8:91350276-91350298 CAGGTTAGGACAAGTGTTGTGGG + Intronic
1044449539 8:92318488-92318510 AAGTTTCAGACATGTGTTTTGGG - Intergenic
1044670735 8:94677988-94678010 CAGGCAAAGAACTGTTTTTTAGG + Intronic
1044912187 8:97072044-97072066 GAGTTTAAGAAACTTGTTTTAGG - Intronic
1044930730 8:97249274-97249296 AACGTTAAGAAATGAGCTTTGGG + Intergenic
1045151101 8:99409129-99409151 CAGATTCAGAAAAGAGTTTTAGG + Intronic
1046451649 8:114399875-114399897 CAGCTTAGGAAATGTATTTGAGG + Intergenic
1046467247 8:114621414-114621436 AAAGTTTATAAATGTGTTTTGGG + Intergenic
1047267480 8:123320286-123320308 AACCTTAAGAAATGTATTTTTGG + Exonic
1048203227 8:132394310-132394332 ATGGTTAAGCCATGTGTTTTTGG + Intronic
1048698354 8:137055028-137055050 CATGTTATGAAAGTTGTTTTAGG + Intergenic
1048844732 8:138595574-138595596 CACGTTAAGGAGTGGGTTTTGGG - Intronic
1049454676 8:142680910-142680932 CAGGCTAAGAAGTGGTTTTTGGG + Intronic
1049481167 8:142823714-142823736 CAGGTTATGAAATGTGCAGTTGG + Intergenic
1049515981 8:143056230-143056252 CAGGTTGATAAATGTGTTTTAGG - Intronic
1050348008 9:4712154-4712176 CAGGTTAAGAAATGTGTTTTAGG - Exonic
1050530802 9:6587549-6587571 CATGGAAAGAAATCTGTTTTGGG - Intronic
1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG + Intronic
1053096594 9:35333917-35333939 CAGGTTGAGAAAACTGCTTTGGG + Intronic
1053223083 9:36327545-36327567 CAGGAGAAGAAATGTGTTTGCGG + Intergenic
1055235831 9:74122242-74122264 CAGCTTAATAAATTAGTTTTTGG + Intergenic
1055269571 9:74542768-74542790 AAGATTGAGAAATGTGTTCTTGG - Intronic
1055709435 9:79044065-79044087 GAGGTTAAGAATTGTGCCTTAGG + Intergenic
1055863494 9:80783990-80784012 TAGGTTGAGTAATATGTTTTTGG + Intergenic
1057725777 9:97567290-97567312 CAGGTCCACAAATGTTTTTTGGG + Intronic
1058015921 9:100031950-100031972 CTACTTAAGAAATGTATTTTTGG + Intronic
1058232518 9:102446741-102446763 CATATTATGAAATCTGTTTTTGG - Intergenic
1058487393 9:105455683-105455705 GATGTTAAGAAACTTGTTTTAGG - Intronic
1058777402 9:108297920-108297942 CAGTTTAAGTAATGTGTTCAAGG - Intergenic
1059707052 9:116835338-116835360 TATGTCAAGAAACGTGTTTTGGG - Intronic
1061522726 9:131130005-131130027 CTGGTTTAGAAGTGTTTTTTGGG + Intronic
1061641697 9:131963046-131963068 CAGGTTTAGAAATTTATGTTCGG - Intronic
1203687979 Un_GL000214v1:13391-13413 CATGTTAAAAAATATGTTTTAGG + Intergenic
1203754645 Un_GL000218v1:114351-114373 CATCTTAAAAAATATGTTTTAGG - Intergenic
1203714030 Un_KI270742v1:126863-126885 CACCTTAAAAAATATGTTTTAGG - Intergenic
1203537172 Un_KI270743v1:51175-51197 CATCTTAAAAAATATGTTTTAGG + Intergenic
1203648296 Un_KI270751v1:90662-90684 CATGTTAAAAAATATGTTTTAGG - Intergenic
1185550420 X:979592-979614 TAGGATAAGAAATCTGTCTTAGG + Intergenic
1186179125 X:6955649-6955671 CTGGTTAAGCAATATGTTTTAGG - Intergenic
1186684320 X:11908803-11908825 CAGTTTTATAATTGTGTTTTGGG + Intergenic
1187427969 X:19195858-19195880 CGGGTTAATAAAAGTCTTTTTGG - Intergenic
1187860971 X:23682155-23682177 CAGCTTTAAAAATTTGTTTTTGG - Intronic
1188407320 X:29827712-29827734 GTGGTTAAGTAATTTGTTTTAGG - Intronic
1188598718 X:31933977-31933999 CAAATTAACAAATGTGTATTGGG + Intronic
1188775140 X:34207719-34207741 TAAGTTAGGAAATGTGTGTTAGG + Intergenic
1189605010 X:42667946-42667968 CAGAATAAGAATTGTGTTTCTGG - Intergenic
1189692716 X:43633769-43633791 CAGGTGAAGAAATGTGTAGAGGG + Intergenic
1190408421 X:50110754-50110776 CAGGCTAAGAAATCTTTGTTGGG + Intergenic
1192234912 X:69289642-69289664 CAGGTTGAAAAATGGCTTTTGGG + Intergenic
1192852039 X:74967193-74967215 CAAGCTTAGATATGTGTTTTAGG + Intergenic
1192865283 X:75124983-75125005 AAAGTTAAGAAATGTGCTTGAGG - Intronic
1193363381 X:80601695-80601717 CAGGTTGTGAAGTTTGTTTTTGG - Intergenic
1193654310 X:84181093-84181115 CAGGTTAAAAAATTTGTATTGGG + Intronic
1194081871 X:89477980-89478002 CAAGAGAAGAAATATGTTTTGGG - Intergenic
1194209221 X:91050037-91050059 CAGGTACAGAAGTGTATTTTTGG - Intergenic
1196414153 X:115453588-115453610 CTTTTTAAAAAATGTGTTTTTGG - Intergenic
1196833660 X:119795672-119795694 CAAGTTAAAAAATGTATATTTGG + Intergenic
1197487894 X:127075842-127075864 CATTCTAAGAAATGTGTCTTTGG + Intergenic
1198114073 X:133527999-133528021 AAGGTTAAGAGATTTGTTTAAGG - Intergenic
1198201846 X:134429310-134429332 CAGGTTAGGAATTGTGTGTATGG - Intergenic
1198772171 X:140142237-140142259 CAGATTAAAAAATGAGTCTTGGG + Intergenic
1198968471 X:142252520-142252542 CATTTGAAGAAATGTGTATTAGG + Intergenic
1199266734 X:145836866-145836888 CTTTTTAAGAAATGTGTATTCGG + Intergenic
1200434539 Y:3134170-3134192 CAAGAGAAGAAATATGTTTTGGG - Intergenic
1201168271 Y:11231973-11231995 CATCTTAAAAAATATGTTTTAGG - Intergenic
1201593018 Y:15636503-15636525 CATGTTGAGAAATGAGTGTTAGG - Intergenic
1201776559 Y:17672125-17672147 CAGGTTAAAAACACTGTTTTTGG - Intergenic
1201824997 Y:18233867-18233889 CAGGTTAAAAACACTGTTTTTGG + Intergenic