ID: 1050348679

View in Genome Browser
Species Human (GRCh38)
Location 9:4718944-4718966
Sequence AGGTTGCCCCAGGAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050348679_1050348682 -4 Left 1050348679 9:4718944-4718966 CCCTGCTGCTCCTGGGGCAACCT 0: 1
1: 0
2: 4
3: 29
4: 280
Right 1050348682 9:4718963-4718985 ACCTTTCGCACCAAGCTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050348679 Original CRISPR AGGTTGCCCCAGGAGCAGCA GGG (reversed) Intronic
900175850 1:1291053-1291075 ATCCTGCCCCAGGAGCAGCCTGG + Exonic
900492458 1:2959108-2959130 AGGTTGCCTCAGGATCAACAGGG - Intergenic
900737802 1:4310140-4310162 TGGCTGGCCCAGGTGCAGCAGGG - Intergenic
901494503 1:9613507-9613529 AGGTTGCCCCAGGTGAGACAGGG - Exonic
901677183 1:10892374-10892396 TGACTGTCCCAGGAGCAGCAAGG - Intergenic
902200024 1:14826508-14826530 AGCCGCCCCCAGGAGCAGCAAGG - Intronic
902846376 1:19113807-19113829 AGGATGACTCAGGAACAGCAGGG - Exonic
903173360 1:21567028-21567050 AAGGTGCCCCAGGACCAGCCTGG - Intronic
903232641 1:21931347-21931369 AGCTGGCCCCGGGAGCAGGAGGG + Intronic
903831757 1:26179436-26179458 AGGGTGTTCCAGGAGCTGCAAGG + Intronic
904103625 1:28056337-28056359 AGGTTTCCACAGGAAAAGCAAGG - Intronic
904328041 1:29740125-29740147 AGGAGGCCCCATGAGCTGCAGGG + Intergenic
904788253 1:32998594-32998616 AGGATGCCCAAGGAGCTGCAGGG - Intergenic
904800619 1:33090422-33090444 AGGAGGCCCCAAGAGGAGCAGGG + Intronic
905250959 1:36648044-36648066 AGGTTGGCCCAGGGACAGAAAGG - Intergenic
905434817 1:37949029-37949051 TGGTGGCCCCAGGAGCTGCCTGG + Intergenic
907356572 1:53879902-53879924 TGGCTCACCCAGGAGCAGCACGG + Intronic
907519803 1:55015730-55015752 AGGTTCCCCCAAGACAAGCATGG - Intergenic
909427171 1:75538960-75538982 TGCTTGCCCCAGGAGCACCATGG + Intronic
911196721 1:95002281-95002303 AAGCGGCCCCAGCAGCAGCATGG + Intronic
912470859 1:109905837-109905859 AGGTTGCCCCATGTGAAGGAAGG - Intergenic
912542396 1:110427007-110427029 AGGATGCCCCAGAGGCAGCGTGG + Intergenic
913269112 1:117075576-117075598 AGGCTGCACCAGCAGCACCAGGG + Exonic
915163661 1:153936297-153936319 AGGTAGCCCCAGGACCTGCCAGG - Intronic
915912701 1:159924517-159924539 AGGTAGCCCCAGGAGGCACAGGG + Intronic
918139947 1:181711758-181711780 GGGGTGCCCAAGGAGCAGAAGGG + Intronic
919507053 1:198412341-198412363 CGGTTGACCCAGGAGCAACATGG - Intergenic
919666740 1:200299987-200300009 ACCCTGCCCCAGCAGCAGCACGG + Intergenic
920943009 1:210501634-210501656 ATTTTTCCCCAGGAGCAGCTGGG - Intronic
922700637 1:227758016-227758038 AGGGTGCTCCAGGAACAGCCTGG + Intronic
1062975357 10:1678724-1678746 AGTTTGCCCGAGGTGCAGCTGGG + Intronic
1064638085 10:17388941-17388963 TGGTATCCCCAGGAGCAACATGG - Intronic
1065204061 10:23341713-23341735 TGGATGTCCTAGGAGCAGCAAGG - Intronic
1065746119 10:28844171-28844193 AGGTTGACTGAGGAGCAGAAGGG + Intergenic
1067122414 10:43485048-43485070 AGTTGGATCCAGGAGCAGCAAGG + Intergenic
1067695038 10:48528460-48528482 AGGTTGCCCCGGGAGCTGTAGGG + Intronic
1069634988 10:69919663-69919685 AGGGAGACCCAGGAGCAGAAGGG + Intronic
1069785899 10:70987775-70987797 GGGTTGCCCCTGAAGCAGCATGG + Intergenic
1070783279 10:79149525-79149547 AGCTTGGCCCAGGGGCTGCAAGG - Intronic
1072761078 10:98057362-98057384 AGCTGGCCCCAGTAACAGCAAGG - Intergenic
1074026638 10:109642580-109642602 AGAAAGCCCCAGCAGCAGCAGGG + Intergenic
1075067047 10:119296072-119296094 AGGTGGCCCCAGGACGAGCTTGG + Intronic
1076437253 10:130454716-130454738 AGAAGGCCCCAGGAGCAGAACGG - Intergenic
1076667888 10:132103223-132103245 AGGAGGCCCCAGGAGCAGGAGGG + Intergenic
1076784963 10:132745236-132745258 AGGTGTCCCCAGGAGCATCGTGG - Intronic
1076812277 10:132893437-132893459 AGGTTCACCCAGGAGGAGGAGGG - Intronic
1077087823 11:763342-763364 AGGGAGCTCGAGGAGCAGCACGG + Exonic
1077319922 11:1936534-1936556 CGGCTGGCCCAGGAGCAGCAGGG + Intronic
1077353811 11:2105506-2105528 AGGGTGCTCCTGGGGCAGCAGGG - Intergenic
1077410519 11:2401797-2401819 AGGTCGCTCCAGGAGCCGCGGGG + Intronic
1077556840 11:3230122-3230144 AGGTAACCACAGGGGCAGCATGG - Intronic
1079122620 11:17696247-17696269 AGGCTGCCCCAGGGGCAGTGGGG + Intergenic
1079244236 11:18741310-18741332 AGGGAGTCCCAGGAGCAGCACGG + Intronic
1079328023 11:19511266-19511288 AGGTAGCCCCAGTGGCACCATGG + Intronic
1080227787 11:29979478-29979500 GGGCTGCCCAAGCAGCAGCAAGG + Intergenic
1080863251 11:36169109-36169131 GTTTTGCCCCAGGAGGAGCAGGG - Intronic
1081656907 11:44863358-44863380 AGATGGCCCCAGGCCCAGCACGG - Intronic
1081709666 11:45208760-45208782 AGGTTGCCCCAGGTGCCTCCTGG + Intronic
1081896801 11:46593807-46593829 AGGTAGGCCCAGGAGGAGCCTGG - Intronic
1082125882 11:48430410-48430432 TGGCTCACCCAGGAGCAGCAGGG - Intergenic
1082559472 11:54601266-54601288 TGGCTCACCCAGGAGCAGCAGGG - Intergenic
1083370673 11:62177113-62177135 AGGTTGACCCTTGAGCAACATGG + Intergenic
1083384144 11:62295329-62295351 ATGTGGCCACAGGACCAGCATGG + Intergenic
1083580990 11:63825281-63825303 TGGCTTCCCCAGGAACAGCAAGG - Intronic
1084182244 11:67452590-67452612 TGGCAGCCCAAGGAGCAGCAGGG + Exonic
1084459617 11:69289206-69289228 TCTCTGCCCCAGGAGCAGCAGGG + Intergenic
1084651212 11:70490490-70490512 AGGTGGCTCCAGAAGCAGCTTGG - Intronic
1085151239 11:74254196-74254218 AGGAGGCCCCTGGAGCAGCCTGG - Exonic
1086926616 11:92647831-92647853 AGATTGCTCCAGGATAAGCAGGG + Intronic
1090248647 11:125235972-125235994 AGGTAGCCCCATAAGCAGCGTGG - Intronic
1090404932 11:126470734-126470756 GGCTTGCCCTAGGAGGAGCATGG + Intronic
1090478930 11:127050513-127050535 AGGTTTCCAGAGGAGCTGCATGG - Intergenic
1090807093 11:130209577-130209599 AGGTGGCCCCCGGGGCAGGAGGG + Exonic
1091346279 11:134856506-134856528 AGGGTGCTCCAGGCCCAGCAAGG + Intergenic
1091587305 12:1823527-1823549 AGGAGGCCCCAGTAGGAGCAGGG - Intronic
1091927966 12:4370839-4370861 ATGTGGCCCCAGGAGGAGCTGGG - Intronic
1094808035 12:34109530-34109552 AGGCTGTACCAGGAGCTGCAGGG - Intergenic
1096053742 12:48633591-48633613 AGGCAGCTGCAGGAGCAGCAAGG - Intergenic
1096191211 12:49621440-49621462 AGGTTGCCAGATGTGCAGCAAGG + Intronic
1096504588 12:52084746-52084768 AGCTTACCCCAGGAGCAGTGAGG + Intergenic
1096549049 12:52360318-52360340 AGGTTAGCCCAGAAGCAGGAAGG + Exonic
1098808321 12:75050492-75050514 AGCTTGCCTGAGGAGCAGGAGGG + Exonic
1100519284 12:95357857-95357879 GGGTTGCTGCAGGAGCAGCTTGG - Intergenic
1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG + Exonic
1101877102 12:108603284-108603306 TGGCTGCCCCAGGAGCAGATGGG - Intergenic
1102469297 12:113150519-113150541 AGGTGACCCCAGGAGCCGGAAGG - Intronic
1102796692 12:115695178-115695200 CGGCTGCCCAAGGAGCAGCATGG - Intergenic
1102823560 12:115927591-115927613 AGCTAGCCCCAGGGCCAGCATGG + Intergenic
1102855643 12:116290671-116290693 AGGTTTCCTGAGGAGCTGCAGGG + Intergenic
1103252117 12:119508928-119508950 AGTTTGCCCCAGGAGAACCATGG - Intronic
1103541551 12:121669674-121669696 AGGGGGCCCCAGGAGAGGCAAGG - Intronic
1103984536 12:124758546-124758568 AGGTGGCCCCAGGGGCGTCATGG - Intergenic
1104758787 12:131284730-131284752 AGGCAGCCCCGGGTGCAGCAGGG + Intergenic
1104821814 12:131681795-131681817 AGGCAGCCCCGGGTGCAGCAGGG - Intergenic
1107862220 13:44671685-44671707 AGCGGGCCGCAGGAGCAGCAGGG - Intergenic
1113480224 13:110615225-110615247 AGGTTGCGCCTGGAGCAGAAAGG + Intergenic
1113517267 13:110913612-110913634 ATGTAGCACCAGGGGCAGCAAGG + Intronic
1113630334 13:111878176-111878198 AGGCTGCCCCAGGAACAGGACGG + Intergenic
1113885934 13:113658382-113658404 AGGGCGTCCCAAGAGCAGCAGGG - Intergenic
1113941661 13:114021582-114021604 TTGTTCCCCCAGGAGCAGAATGG + Intronic
1114618726 14:24082241-24082263 AGGCTGAACCAGGAGGAGCAGGG - Intronic
1116679601 14:47949126-47949148 AGGTTACCACAGGAACAGGAGGG + Intergenic
1119475027 14:74922311-74922333 AGATTCCCACAGGAGGAGCAGGG - Exonic
1119777353 14:77257367-77257389 AGATGTCCCCAGGAGCAGCAGGG + Exonic
1121155076 14:91675568-91675590 AGATGGCCCCATGAGCAGCTAGG - Intronic
1121248743 14:92483910-92483932 AGGTGGCCCCTGGGCCAGCATGG - Intronic
1122243464 14:100384159-100384181 AGGTTGGGCCAGGGTCAGCATGG + Intronic
1122556043 14:102580606-102580628 GGGTTGTTCCAGGAGCATCAGGG + Intergenic
1122860748 14:104581365-104581387 TGGTGGCCCCAGGAGGAGCTGGG - Intronic
1122873363 14:104651402-104651424 AGGTGGCTCCAGGAGGAGCTAGG - Intergenic
1123048729 14:105530639-105530661 TCGCAGCCCCAGGAGCAGCACGG + Intergenic
1124143950 15:27103488-27103510 GGGTTGCCCCTGCAGCTGCAGGG + Intronic
1124585691 15:31004397-31004419 AGGTAGCCACAGAAGCAGCAGGG - Intronic
1124594507 15:31081860-31081882 AGGTCACCCCAGGAGAGGCATGG + Intronic
1125770005 15:42159012-42159034 TGCTTCCTCCAGGAGCAGCAGGG - Exonic
1127615412 15:60680079-60680101 AACTTCCCCCAGCAGCAGCAGGG + Intronic
1129408801 15:75337659-75337681 GGTGTGCCCCAGCAGCAGCAGGG + Intronic
1129717498 15:77860687-77860709 AGAGTGGCCCAGGGGCAGCAGGG - Intergenic
1129717909 15:77862662-77862684 AGCTTGCAGCAGGAGCAGGAGGG - Intergenic
1130461254 15:84159510-84159532 AGAGTGGCCCAGGGGCAGCAGGG + Intergenic
1131259696 15:90882038-90882060 AGGTGGGCCCAGGACCAGCTGGG + Exonic
1131645260 15:94335203-94335225 AGGTTCACTCACGAGCAGCAGGG - Intronic
1132546000 16:533740-533762 AGGCAGCCCGGGGAGCAGCAGGG - Intronic
1132627341 16:897768-897790 AGGGTGGCCCAGCTGCAGCAGGG + Intronic
1136096564 16:27961336-27961358 AAGTTGACCCAGGAGCTCCAAGG + Intronic
1137324198 16:47416742-47416764 AGGCTTCCCCAGAAGAAGCATGG + Intronic
1137365421 16:47855639-47855661 AGGCTGGCTCAGGAGCAGCCAGG + Intergenic
1137393898 16:48103653-48103675 AGCTCACCCCAGGAACAGCAGGG + Intronic
1137859251 16:51829959-51829981 AGCTTGCCCCAGGAGCACCTTGG - Intergenic
1138151168 16:54658527-54658549 ACAGTGTCCCAGGAGCAGCAAGG + Intergenic
1138992196 16:62404997-62405019 AAGTAGCCCCAGGGGCTGCAGGG - Intergenic
1140259568 16:73365765-73365787 AGGTGGCTCCAGGATCAGGAGGG - Intergenic
1140530341 16:75660368-75660390 ATCTTGCCCCAGAGGCAGCAGGG + Intronic
1141648046 16:85377913-85377935 AGGCTGCCCAAGGAGCGGCCAGG - Intergenic
1142073875 16:88106261-88106283 AGGTGGGCGCAGGAGCGGCATGG - Intronic
1142599030 17:1044087-1044109 AGGTTGCAGCTGGAGCGGCAAGG + Intronic
1143914424 17:10278490-10278512 AGGTTGACAAAGGAGCAGGAGGG + Intergenic
1144788591 17:17845294-17845316 TGGCTGCCCCAGGGGCAGCAGGG - Intronic
1145011645 17:19371735-19371757 AGATGGCCCCTGGAGCAGGAGGG + Intronic
1145818385 17:27811953-27811975 AGGTTGCTGCAGGAGGAGCAGGG + Intronic
1147357282 17:39907966-39907988 AAGTTGTCCTAGGAGCAGCCTGG + Intronic
1148205087 17:45775048-45775070 AGGCTGCCACGGGAGCCGCAAGG + Intergenic
1148236949 17:45975339-45975361 AGGCTTCCCCAGTAGCTGCAGGG - Intronic
1149006000 17:51806009-51806031 AGCTTGGCCCAGGAGCAGAAAGG + Intronic
1149426303 17:56557869-56557891 AGGTACCCCCTGGAGCAGCGTGG - Intergenic
1152661960 17:81546650-81546672 AGGATGCCCCAGGAGCAGCTGGG + Intronic
1152761230 17:82108009-82108031 AGCCTGCCCCAGGAGCAGGTGGG - Intronic
1155233759 18:23798525-23798547 AGCTTCTCCCAGGAGCATCACGG - Intronic
1155650250 18:28132659-28132681 TGGATGGCACAGGAGCAGCAGGG + Intronic
1155775891 18:29760559-29760581 AGGTTGATCCAGCTGCAGCATGG - Intergenic
1156328195 18:36093573-36093595 GGGGTGGCTCAGGAGCAGCACGG + Intergenic
1156486828 18:37471713-37471735 GGGAAGCCCCAGGGGCAGCAGGG + Intronic
1157670710 18:49526208-49526230 AGCAAGCCCCAGGAGCATCAAGG + Intergenic
1157751156 18:50179672-50179694 AGGCTGTCCCATCAGCAGCAGGG - Intronic
1161235448 19:3196008-3196030 AGGTTGTCCTAGGGGGAGCACGG + Intronic
1161436906 19:4268911-4268933 AGGTGGGGGCAGGAGCAGCAGGG - Exonic
1161483789 19:4524033-4524055 AGCCTGACCCAGGAGCTGCAGGG - Exonic
1161847026 19:6718060-6718082 AGGGGGCCCCAGGGGAAGCAGGG - Intronic
1161932533 19:7350244-7350266 AGGTGGCCCCAGAACCAGGAGGG + Intronic
1163801223 19:19367038-19367060 ATGGTGGCCCAGGAGCAGCAAGG + Intergenic
1163801505 19:19368463-19368485 AGGTTGCTCAGGAAGCAGCATGG - Intergenic
1166226326 19:41397889-41397911 AGGCTGCCGCAGCAGCAGGAGGG - Exonic
1167494825 19:49811541-49811563 AGGCTGCCCCAGGGGCTGCTGGG + Intronic
1167506263 19:49872708-49872730 AGCTGGCCCCAGGACCAGTAAGG + Intronic
1167700275 19:51039506-51039528 AAGGTTCCCCAGGAGCAGCTGGG + Intergenic
1167924155 19:52809935-52809957 AGGTTGCCCCGGGGGGCGCAGGG + Intronic
1168065506 19:53917499-53917521 AGGTTGCACCAAGAGGAGCCTGG - Intronic
1168269283 19:55240993-55241015 AGGTGGCCCCAAGCTCAGCATGG + Exonic
925613229 2:5720900-5720922 AAGTGGTCACAGGAGCAGCATGG + Intergenic
925746799 2:7050565-7050587 AGAATGCCCCAGGAACAGAATGG - Intronic
926043080 2:9690347-9690369 AGGTTGCCTCAGGACCTGCCTGG - Intergenic
927204002 2:20595529-20595551 TGGTTGCTACAGGATCAGCAAGG - Intronic
928446982 2:31341256-31341278 AGGTGGCCCCAGGAGGGGAATGG + Intronic
932265471 2:70364006-70364028 AGGGTGCCCCAAGAGCAGCATGG + Intergenic
932609074 2:73185309-73185331 AGGCTGCCGGAGGAGCAGGATGG + Intergenic
932993757 2:76821878-76821900 AGGATGCCCCAGGAGGAACAGGG - Intronic
933090670 2:78112018-78112040 TGGCTGGCCCAGAAGCAGCAGGG + Intergenic
933344974 2:81071849-81071871 AGGTGGACCCAGTAGCAGAATGG + Intergenic
933784594 2:85828493-85828515 AGGTGGCGCCAGGAGCCACAGGG + Intergenic
934156599 2:89207030-89207052 AGGTTGCACCAGGAGTAGCAAGG - Intergenic
934210716 2:89975721-89975743 AGGTTGCACCAGGAGTAGCAAGG + Intergenic
934662902 2:96152703-96152725 AGGAGGCTCCAGGATCAGCAGGG + Intergenic
934941890 2:98508770-98508792 AGCGTGCACCAGGAGCAGCGCGG - Intronic
936049668 2:109213475-109213497 ACGTGGCCCCAGGATCTGCAGGG + Intronic
936502789 2:113079459-113079481 AGGTAGCACCAGGAGCAGGGTGG + Intergenic
938836776 2:135112079-135112101 AGGTGGCCCCAGGAGTTGTATGG - Intronic
940806663 2:158195032-158195054 AGATGGACCCAGGACCAGCATGG - Intronic
944167993 2:196743353-196743375 CGGCTCACCCAGGAGCAGCAGGG - Intronic
945611484 2:212010133-212010155 AGGATGCTCCACGAGCAACAAGG - Intronic
948587444 2:239028176-239028198 GGGTGGGCCCAGGCGCAGCATGG + Intergenic
948866239 2:240776181-240776203 TGGGTGGCCCAGGGGCAGCAGGG - Intronic
948897511 2:240934209-240934231 AGGGAGGCCCAGGAGGAGCATGG - Intronic
948973577 2:241448226-241448248 GGGTGGCCCCAGGACCAGGAGGG - Intronic
1168764699 20:373741-373763 CGGTTGCCCCAGGGGCGGCCTGG - Intronic
1168863008 20:1059658-1059680 AGGTTGCCCCAGGAAGGGCATGG + Intergenic
1169424370 20:5484912-5484934 ACCTTGCCACAGGGGCAGCAGGG - Intergenic
1170152500 20:13239999-13240021 AGGTTGTTACAGGAGCAGAAAGG + Intronic
1170996942 20:21370931-21370953 TGGTTGCCACAAGGGCAGCATGG + Intronic
1171189817 20:23150983-23151005 AGGCTGCCCCAGGAGGAAGAGGG + Intergenic
1171367393 20:24634999-24635021 CGGCAGCCCCAGGAGCAGCCTGG + Intronic
1172624833 20:36340980-36341002 AGTTTGTTCCAGGAGGAGCATGG - Intronic
1172753778 20:37269449-37269471 AGGTTACCCGAGGATCAGCTGGG - Intergenic
1173835927 20:46125659-46125681 AGGTGGCCCCAGGAGGAGTGGGG - Intronic
1174568797 20:51486331-51486353 GGCTTGTTCCAGGAGCAGCAAGG - Intronic
1175033898 20:55981636-55981658 AGGTTGCCCTAGGAAGAGTATGG - Intergenic
1175162707 20:57020823-57020845 AGGTGGCTCCAGGAGTGGCAAGG - Intergenic
1175413158 20:58784783-58784805 CAGGAGCCCCAGGAGCAGCACGG + Intergenic
1175581537 20:60103679-60103701 AGCCTGTCCCAGGAGAAGCAGGG + Intergenic
1175894620 20:62330655-62330677 AGGTTGTCCAGGGGGCAGCAGGG - Intronic
1176517195 21:7794587-7794609 AAGTTTCCCCAGGAGCAGGGAGG + Intergenic
1178122012 21:29478628-29478650 AGGATGCCACAGGAGCAAAAAGG + Intronic
1178651223 21:34424599-34424621 AAGTTTCCCCAGGAGCAGGGAGG + Intergenic
1178989752 21:37342956-37342978 GGGTTGCCCCCGGAGTAGCTAGG - Intergenic
1179729631 21:43360559-43360581 TGGTTCCCACAGGAGGAGCAGGG + Intergenic
1180731808 22:17987989-17988011 AGGCTGCCCCAGTCACAGCAGGG + Intronic
1180995659 22:19963969-19963991 AGGTGGCACCAGGAGGGGCAGGG + Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1182461218 22:30485425-30485447 AGGTGGCCCCACGAACAGCCTGG + Intergenic
1183252963 22:36743373-36743395 AGGTTGCCCCAAAAGTAGCATGG - Intergenic
1183293379 22:37016395-37016417 AGTTTCCCTCAGGAGCATCAGGG - Intronic
1183381145 22:37491164-37491186 AGGCTGCCCCAGCAGCAGTGAGG - Exonic
1183512679 22:38245196-38245218 AGGTGGCCCCAGGTGCAGTTGGG - Intronic
1183780546 22:39995986-39996008 GGGTGGTCCAAGGAGCAGCATGG - Intronic
1184113077 22:42406509-42406531 GGGGTGTCCCAGGAGCTGCATGG - Intronic
1184842087 22:47058032-47058054 GGGCTGCCCTAGGTGCAGCAAGG + Intronic
1184987445 22:48145372-48145394 ACTTGGCCCCAGGAGCAGCAGGG - Intergenic
1185070926 22:48655189-48655211 GGTTTGCTCCAGGAGCAGCCAGG - Intronic
1185088701 22:48754212-48754234 GGGATGACCCAGCAGCAGCAGGG + Intronic
950039524 3:9911049-9911071 AGGTTCCCCCAGGACCAGGGTGG + Intronic
950266505 3:11577101-11577123 GGGTTTCCCCAGGAGCCCCAGGG - Intronic
950585614 3:13890304-13890326 AGGAAGCCCCTGGAGCAGGAGGG + Intergenic
953968465 3:47328522-47328544 AAGTTGCCCCATGAGCATCAGGG + Intronic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954406828 3:50349872-50349894 GGGTTGTCCCAGGAGGAGGAAGG - Intronic
958717116 3:97797489-97797511 AGGGTTGCCTAGGAGCAGCATGG + Intronic
960305095 3:116051185-116051207 AGGCCGGCCCAGGAGCAGCAAGG + Intronic
964746207 3:160014931-160014953 AGGTTCCCCCAAGAACAACAGGG - Intergenic
965000315 3:162944688-162944710 AACTTGCCACAGGAGCAGAAGGG + Intergenic
968691585 4:1992903-1992925 TGGTTGCCCAAGGAACAGAAGGG - Intronic
973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG + Intronic
976177397 4:82368783-82368805 AGATTGCCCCAGAAGCACTAAGG + Intronic
983499327 4:168481104-168481126 AGGGTGCCCCAGTAACGGCATGG + Intronic
983913361 4:173265130-173265152 CGGTTTCCCCAGGAGCAGGCAGG + Intronic
985651429 5:1109535-1109557 AGGCTCCACCAGAAGCAGCAGGG + Intronic
990439506 5:55830646-55830668 AGGATGGCACAGCAGCAGCAAGG - Intergenic
994093160 5:95826164-95826186 AGATTGCCCCAGCAGCAGTGTGG - Intergenic
994801460 5:104382519-104382541 ATGTTGCACAAGGAGCAGCCAGG - Intergenic
998214484 5:140227077-140227099 AGGTGGCCCCTGGAGCATCATGG + Intronic
998269170 5:140691346-140691368 TGGTTGCCCCAGCCTCAGCAAGG + Exonic
998642918 5:144032385-144032407 ATGGAGCCCCAGGAGCTGCAAGG - Intergenic
1003313258 6:4987442-4987464 AGGTTGCCCCAGCTAGAGCAGGG + Intergenic
1004188773 6:13446325-13446347 AGGCTGCCCCAGGAGAATGAGGG + Intronic
1004235937 6:13874188-13874210 TGGGTGCCCTAGGAGCAGCCCGG - Intergenic
1005332190 6:24761247-24761269 AGCTGGCACCAGGAGCAGAAAGG + Intergenic
1006152294 6:31995983-31996005 AGTTTGGCCCAGGAGCAGGTAGG + Exonic
1006158597 6:32028721-32028743 AGTTTGGCCCAGGAGCAGGTAGG + Exonic
1007274388 6:40662760-40662782 GGGAGGCCCCAGGTGCAGCATGG - Intergenic
1010535138 6:77017579-77017601 AGCTTGCTTGAGGAGCAGCAAGG + Intergenic
1012551471 6:100467677-100467699 GGGTTGCCCCAGAAGTGGCAGGG - Intergenic
1014286024 6:119498994-119499016 TGGTTGCCCCTGGAGGGGCAGGG - Intergenic
1018625130 6:165770853-165770875 AGGTGGCCCCGGGAGCACCTGGG - Intronic
1018845340 6:167551807-167551829 AGGGTCCCCCAGGACCAGCTGGG + Intergenic
1019279945 7:194518-194540 AGGTTACCCCAGCAGCAGAGGGG + Intronic
1019563016 7:1667262-1667284 AGGCTGCCCAGGGAGGAGCAGGG + Intergenic
1019610878 7:1936079-1936101 AGGGTGCCCCTGAAGGAGCAGGG - Intronic
1019989837 7:4683180-4683202 GGGTGACCCCAGGAGCCGCAAGG - Intronic
1025790738 7:64684809-64684831 AGGTAGCCAAAGGAGCAGGAGGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028667016 7:93357360-93357382 ACATTTCCCCAGCAGCAGCAGGG + Intronic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029576752 7:101408398-101408420 AGGGTGCCCCAGGAAGAGCTGGG + Intronic
1032515986 7:132506688-132506710 GGGTTACCCCAGGTGAAGCAGGG - Intronic
1034816820 7:154179013-154179035 AGGATGGCCCAGAAGCAACAGGG + Intronic
1035172028 7:157022139-157022161 AGGCTGCCCCGGGAGAAGCCGGG - Intergenic
1035331994 7:158102430-158102452 AGGTGCCTCCATGAGCAGCAGGG - Intronic
1035577583 8:717704-717726 TGGCTGCCCCAGGCCCAGCAAGG - Intronic
1037328182 8:17716218-17716240 AGAATGCCCCAGGTGCAGCTAGG + Intronic
1038019540 8:23541358-23541380 GGGGTCCCCCAGGAGCAGGAAGG + Intronic
1038323113 8:26547689-26547711 ATGTAGCACCTGGAGCAGCATGG + Intronic
1038565693 8:28618566-28618588 AGGTTGAACCTGGCGCAGCAAGG + Intronic
1039533559 8:38286768-38286790 AGTGTGCTCCAGGAACAGCAGGG - Intronic
1041225438 8:55692752-55692774 AGGATGCCCGAGAAGCACCAGGG - Intergenic
1043651252 8:82595844-82595866 AGGTTAGCCCATAAGCAGCAGGG + Intergenic
1044860709 8:96520819-96520841 AGGTTCCCCCAGGGGCACAAGGG - Intronic
1044986579 8:97761360-97761382 GGGCTGCCTCAGGAGCTGCAGGG + Intergenic
1045328876 8:101138055-101138077 AGGGTGCACATGGAGCAGCAAGG - Intergenic
1046550065 8:115704913-115704935 AGATTGCCCCAGGAGCAGGTAGG + Intronic
1048306918 8:133290881-133290903 AGGTTGCCCCGGGAGAGGCTGGG + Intronic
1049263497 8:141652640-141652662 AGGTGCCCCCATGAGGAGCAGGG + Intergenic
1049308347 8:141920020-141920042 AGCTGGCCCCAGATGCAGCAGGG - Intergenic
1049325551 8:142019690-142019712 GGGATGCCCTAGGAGCCGCATGG - Intergenic
1049731386 8:144180354-144180376 GGCCTGCCCCAGGAGGAGCACGG + Intronic
1050348679 9:4718944-4718966 AGGTTGCCCCAGGAGCAGCAGGG - Intronic
1050813783 9:9782612-9782634 ATTTTTCCCCAGGAACAGCATGG - Intronic
1056705877 9:88952500-88952522 GTGTGGCCCCAGGATCAGCAGGG - Intergenic
1056721529 9:89076133-89076155 AGGATGCCCCAGGATGAGCTGGG + Intronic
1060420778 9:123468157-123468179 GGGTGGCACCAAGAGCAGCAAGG - Intronic
1060604147 9:124899286-124899308 GGGTGGGCCCAGGAGCACCAGGG - Intronic
1061389091 9:130307320-130307342 GGGGTGCTCCAGGGGCAGCAAGG + Intronic
1061952293 9:133943296-133943318 AGGTTGCTGCAGGTGCATCATGG + Intronic
1062321537 9:135992742-135992764 GGGCTGCCCCGGGAGCCGCATGG - Intergenic
1062500729 9:136850930-136850952 AGGCTGCCGCAGGAGCAGGCAGG - Exonic
1062745945 9:138212080-138212102 AGGCTGCTCCTGGAGCAGCCTGG - Intergenic
1185737623 X:2505018-2505040 GGATTCCACCAGGAGCAGCAGGG + Intergenic
1186097781 X:6120806-6120828 AGGTTGCCCAGGGAGAAGAAAGG + Intronic
1189267231 X:39726107-39726129 AAGTTTGCCCAGCAGCAGCAGGG - Intergenic
1191567836 X:62561885-62561907 AGGAAGCTCCAGGAGTAGCATGG + Intergenic
1192174568 X:68877839-68877861 AGGTTGTGCCAGGAGGAGCTGGG + Intergenic
1197445881 X:126552163-126552185 AGGCTGGCCCAGGACCAACAGGG - Exonic
1198575032 X:138000959-138000981 AGGAGGCCCCAGGCTCAGCAAGG + Intergenic
1198867669 X:141141933-141141955 AGGTTGCCAGAGTACCAGCATGG + Intergenic
1200057971 X:153471384-153471406 AGGTAGCCCCAGGAGCCGTGAGG - Intronic
1202378002 Y:24255634-24255656 AGAGTGGCCCAGGGGCAGCAGGG - Intergenic
1202492780 Y:25414487-25414509 AGAGTGGCCCAGGGGCAGCAGGG + Intergenic