ID: 1050355218

View in Genome Browser
Species Human (GRCh38)
Location 9:4776438-4776460
Sequence ATGCTGCTGTTGTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050355218_1050355220 26 Left 1050355218 9:4776438-4776460 CCCTGTCTCAACAACAGCAGCAT No data
Right 1050355220 9:4776487-4776509 TTTCCAGAAGAGACTAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050355218 Original CRISPR ATGCTGCTGTTGTTGAGACA GGG (reversed) Intergenic
No off target data available for this crispr