ID: 1050355799

View in Genome Browser
Species Human (GRCh38)
Location 9:4781657-4781679
Sequence GTCCACAGCCTGTCATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050355796_1050355799 5 Left 1050355796 9:4781629-4781651 CCTGATTCATGCCATGCAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG 0: 1
1: 0
2: 2
3: 20
4: 151
1050355798_1050355799 -6 Left 1050355798 9:4781640-4781662 CCATGCAGTGGGTACACGTCCAC 0: 1
1: 0
2: 1
3: 1
4: 58
Right 1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG 0: 1
1: 0
2: 2
3: 20
4: 151
1050355793_1050355799 27 Left 1050355793 9:4781607-4781629 CCTCTGCACAGCAGCCAGATGGC 0: 1
1: 3
2: 6
3: 59
4: 1046
Right 1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG 0: 1
1: 0
2: 2
3: 20
4: 151
1050355794_1050355799 13 Left 1050355794 9:4781621-4781643 CCAGATGGCCTGATTCATGCCAT 0: 1
1: 0
2: 1
3: 13
4: 110
Right 1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG 0: 1
1: 0
2: 2
3: 20
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050355799 Original CRISPR GTCCACAGCCTGTCATCTCA TGG Intergenic
900485190 1:2919437-2919459 GTCCACTGCCTCTCATCCCAGGG - Intergenic
901939745 1:12652874-12652896 GTCCACACCCTGGCTTTTCAGGG + Intronic
904409525 1:30317029-30317051 GTCCATAGCCTGTCTCTTCAGGG + Intergenic
905149579 1:35917193-35917215 GTCCACAACCTGTCTGCTCTTGG + Intronic
905295527 1:36952015-36952037 GCCCACAGACTGTCAGCACAGGG + Intronic
911066824 1:93796990-93797012 GTACACAGCCTGTACTCTTAGGG - Intronic
913499427 1:119457524-119457546 GTCCTCAGCTTGTGATTTCATGG - Intergenic
913995168 1:143645847-143645869 GTCCTCATACTGTCCTCTCAAGG + Intergenic
915757266 1:158274777-158274799 GGCCACAGCCTGTTTTCTAAAGG - Intergenic
920506918 1:206521783-206521805 GTCCTCCGTCTGTCTTCTCAGGG + Intronic
921040514 1:211426822-211426844 GTTCACTGAATGTCATCTCAGGG - Intergenic
921202951 1:212824419-212824441 TTCCACAGCCTGTGGTCTCACGG - Intergenic
922607090 1:226896307-226896329 ATCCACAGCCTTACAGCTCAGGG - Intergenic
1064509702 10:16076661-16076683 CTCCACATCCAGTCATATCAGGG + Intergenic
1066617582 10:37311118-37311140 GACCACAGCATCTCATCTCTGGG + Intronic
1067083046 10:43222373-43222395 GTCCCCACCCTTTCATCACATGG - Intronic
1070673168 10:78392496-78392518 TTCCACAGCCTTTTCTCTCAGGG + Intergenic
1070789319 10:79180210-79180232 GTGCACAGCCTGGCACCTCGGGG - Intronic
1074398720 10:113123308-113123330 GGCCAGAGCCTGTCTTTTCAGGG - Intronic
1074867799 10:117555038-117555060 GTCCCCAGCCTCTCACCTCACGG - Intergenic
1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG + Intronic
1080770897 11:35340349-35340371 GTCCACAGTCTGGCCTCTAAGGG + Intronic
1082820662 11:57542705-57542727 CTCCACCTCCTGACATCTCAGGG - Exonic
1084341261 11:68503405-68503427 GTCCACAGCCTGACCTCTGTGGG + Intronic
1086399169 11:86446751-86446773 GGCCACATCCTGTCATGTCCTGG - Intronic
1086593387 11:88542676-88542698 TTTCACAGCCTCTCAACTCAAGG + Intronic
1088811730 11:113396890-113396912 ATCCTCAGCCTGTGATCTCATGG - Intronic
1089300975 11:117498363-117498385 CTCCACAGACTGTCCTCCCACGG - Intronic
1089654115 11:119934715-119934737 GGGCACAGCCCCTCATCTCATGG - Intergenic
1092732263 12:11545979-11546001 GCCCACAACCTGGCAGCTCAGGG - Intergenic
1093862159 12:24179440-24179462 TACCACTGCCTATCATCTCAAGG - Intergenic
1094336004 12:29354647-29354669 GTTCATATCTTGTCATCTCAGGG - Intronic
1095173540 12:39062741-39062763 GGCCAATGCCTGTCATCTCCTGG - Intergenic
1095789332 12:46147195-46147217 GTTCACAGCCTGGCAACTTAGGG - Intergenic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1101533369 12:105595085-105595107 ATCCACAGCCCCTCACCTCAAGG - Intergenic
1101565036 12:105897021-105897043 GTGCACAGATTTTCATCTCAAGG + Intergenic
1105310944 13:19210325-19210347 GTCCAGTGCCTGTAATCTCAGGG + Intergenic
1105361178 13:19717910-19717932 GTCCAGTGCCTGTAATCTCAGGG + Intronic
1108481890 13:50881159-50881181 GTCCCCAGCTTCTCATTTCATGG - Intergenic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1114593825 14:23894101-23894123 TTCCACATCCTTTCATTTCAGGG + Intergenic
1115581491 14:34763481-34763503 GACCATAGCCAGTCATATCAGGG - Intronic
1120282929 14:82462401-82462423 GTTTAAAGCCTGTCATTTCATGG - Intergenic
1120820871 14:88910653-88910675 GGCCACAGCCTGTCCCCACAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122281880 14:100628477-100628499 GCCCACCGCCTCTCATCTCCCGG + Intergenic
1122871585 14:104641237-104641259 CTCCCCAGCCTGCCTTCTCAGGG - Intergenic
1124180501 15:27468517-27468539 GTCCACATCCTGGTATTTCAGGG + Intronic
1124417539 15:29485587-29485609 GTCCCCAGCCTTTCCTTTCATGG - Intronic
1124510088 15:30316540-30316562 CTCCTCAGCCTGTGACCTCATGG - Intergenic
1124732801 15:32214013-32214035 CTCCTCAGCCTGTGACCTCATGG + Intergenic
1126230720 15:46320447-46320469 CTCCTCAGCCTGTCATTTTAAGG + Intergenic
1127249766 15:57220406-57220428 GTCCAGAGCCTGACTTCTCTGGG + Intronic
1129241582 15:74255425-74255447 GGCCACAGCCTGCCCTCCCAGGG - Intronic
1129328820 15:74816398-74816420 GTCCCCAGCCCCTCAGCTCAGGG - Intronic
1132359146 15:101198040-101198062 GACCACAGTCTGTCACCACAGGG - Intronic
1132397487 15:101484964-101484986 GTCCACAGCCAGACATATCCTGG - Intronic
1132418904 15:101647435-101647457 TTGCACAGCCTGGCAACTCAGGG + Intronic
1132974674 16:2705408-2705430 GTCCACAGCCTGGCCTGGCACGG - Intronic
1134226920 16:12398506-12398528 GTCCACAGCCTGTGCTCACAAGG + Intronic
1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG + Intronic
1136471208 16:30481801-30481823 GTGCACAGTCTGTAATCCCAGGG + Intronic
1137669213 16:50269596-50269618 GTCCACTCCCTGTCATTGCAAGG + Intronic
1137732832 16:50701706-50701728 GTTCACATCCTGTCTTCTCTGGG - Intronic
1139569845 16:67804955-67804977 GCCACCGGCCTGTCATCTCAGGG - Intronic
1144824552 17:18098457-18098479 GTCCAGAGCCTGTCCTGACATGG - Intronic
1148653477 17:49266298-49266320 TTCCCCAGCAAGTCATCTCAAGG - Intergenic
1151181525 17:72332463-72332485 GTCTTCAGCCTGTGCTCTCATGG - Intergenic
1153810124 18:8744952-8744974 GGCCACAGCCGGACAGCTCAGGG - Intronic
1153893869 18:9541713-9541735 GTCCACGGCCGGGCATCTCCTGG + Intergenic
1154065698 18:11104944-11104966 GGCCACAGCGTGTCCTCTCTGGG + Intronic
1154940026 18:21103013-21103035 GTCCAAAGTCTGATATCTCAGGG - Intronic
1159982241 18:74797450-74797472 GTCGACAGCCTGTCATCTGTTGG - Intronic
1160384649 18:78487879-78487901 TTCCTAAGCCTGTCTTCTCAAGG + Intergenic
1161016995 19:1988029-1988051 CTCCACTGCCTGTTCTCTCAGGG + Intronic
1161329884 19:3681640-3681662 GTCCAATGCCAGTCACCTCATGG - Intronic
1161357342 19:3826308-3826330 GTCCTCAGCCAGGCCTCTCAGGG + Intronic
1162478883 19:10916527-10916549 CCCCACAGCCTGCCTTCTCAGGG + Intronic
1162791557 19:13065673-13065695 GGCCACTGCCTGTCATCCCTTGG + Intronic
1164417853 19:28061177-28061199 GTTCACAGCCATTCTTCTCAGGG + Intergenic
1164705547 19:30316906-30316928 GTCCACAGCCAGGCTTCACAGGG - Intronic
1166978101 19:46616906-46616928 GGCCACAGCCTGCCATGGCAAGG - Intergenic
1167051278 19:47080267-47080289 GTCCTCAGCCTGACTCCTCAGGG + Intronic
1167230593 19:48280504-48280526 GTCCACTGCTTGTCATCTGCAGG - Intronic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
925787421 2:7446515-7446537 TTTCACAACCTGTCGTCTCATGG + Intergenic
926007388 2:9383082-9383104 GTCCACTGCATATCATCTCGGGG + Intronic
926808955 2:16739535-16739557 TTCCACACCCTGATATCTCAGGG + Intergenic
929748716 2:44687355-44687377 GACCACAGCCCCTCCTCTCAAGG - Intronic
930242545 2:48951321-48951343 GTCCAAAAGCAGTCATCTCAGGG - Intergenic
931359658 2:61567258-61567280 TTCCACAGCCTCTCAACACAGGG + Intergenic
933920136 2:87037504-87037526 GTCCAATGCTTGTCATTTCATGG + Intergenic
933931488 2:87156282-87156304 GTCCAATGCTTGTCATTTCATGG - Intergenic
934002861 2:87732389-87732411 GTCCAATGCTTGTCATTTCATGG - Intergenic
936361632 2:111809157-111809179 GTCCAATGCTTGTCATTTCATGG + Exonic
937885186 2:126894755-126894777 GGCCGCTGCCTGTCTTCTCATGG - Intergenic
938229991 2:129649976-129649998 CGCCACCGCCTCTCATCTCATGG - Intergenic
943065739 2:183084293-183084315 GTAGACAGCCTGTAATCCCAAGG + Intronic
945504276 2:210619116-210619138 CCCCACTGCCTGTCTTCTCAAGG - Intronic
946867184 2:224052461-224052483 GTCCTCATCATGTCATATCAAGG + Intergenic
947294599 2:228616780-228616802 GCCCAGAGCCGGTCATATCAAGG + Intergenic
948120649 2:235527756-235527778 GCCCACAGCCTAGCATTTCAAGG + Intronic
948328951 2:237150251-237150273 GTCCATAGCCTCTCCTCCCAGGG + Intergenic
949051560 2:241900408-241900430 GTCCTCAGCCTGTCCTCTCCGGG + Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1169263369 20:4153409-4153431 TTCCTCAGCCTGGCATCCCAGGG - Intronic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1183084612 22:35478827-35478849 GTCCCCAGCCTGTCATTTGAAGG - Intergenic
949351664 3:3129458-3129480 GTACCCAGCCTGTAATCTCTTGG + Intronic
951339302 3:21465442-21465464 GGCCACAGCCTCTCATCACCTGG + Intronic
954775274 3:53011555-53011577 GCCCACAGCCTTTGATCTCTGGG - Intronic
954801500 3:53189680-53189702 GCCCAGAGCCTGTCATCTCCGGG + Intronic
956641280 3:71417919-71417941 ATCCACAGTCTGTCTTCTCGGGG - Intronic
960718037 3:120596702-120596724 GTCCAGAGCCGGTCCTCTCGAGG - Intronic
961507772 3:127382551-127382573 GTCCACAGCCTGTCTTGTTAAGG - Intergenic
965642322 3:170842981-170843003 GTCCACTGCCTGGCAAATCAAGG - Intronic
968317603 3:197737197-197737219 GTCCCCAGCGTGTAATGTCACGG - Intronic
969240836 4:5896255-5896277 TTCCACACCATCTCATCTCAAGG + Intergenic
972363173 4:38347741-38347763 GTCCTCAGCGTGTCCCCTCATGG - Intergenic
973096817 4:46212906-46212928 GTCCACAGGCTTTCATTCCAAGG - Intergenic
973749274 4:53997067-53997089 GTCCGCAGGCTGTCATTTGAGGG - Intronic
975326066 4:73060093-73060115 ATCCACAGCCTGTGATTTCAAGG - Intronic
975343958 4:73273002-73273024 TTCCTCAGACTGTCAGCTCAGGG + Intergenic
980402043 4:132303322-132303344 GTCCATAAACTGTCATGTCAGGG - Intergenic
980901074 4:138905730-138905752 CTCCACCTCCTGTCATATCAGGG + Intergenic
982211594 4:153041191-153041213 GCCCACATCCTGACCTCTCAAGG + Intergenic
988539765 5:32098364-32098386 GTCCACAGGGTGTTTTCTCAGGG + Exonic
991154951 5:63422785-63422807 TTCCCCAGCCTGAAATCTCAAGG + Intergenic
993466753 5:88257007-88257029 GGCTAAAGCCTGTAATCTCAGGG + Intronic
997631241 5:135370258-135370280 GCCCACAGCTTTTCACCTCAGGG - Intronic
998593394 5:143501682-143501704 CTCCATAGCCTGTCATCTCAGGG - Intergenic
999250482 5:150179633-150179655 GACCACTGCCTGTCATCCCTAGG + Intronic
1001579987 5:172791755-172791777 GTCCACAGTCTGTCCCCTCTTGG - Intergenic
1002311744 5:178319201-178319223 CCCCAGAGCCTGTCATCTCCTGG + Intronic
1003429085 6:6022504-6022526 GGCCACAGCCTGCCTTCCCATGG - Intergenic
1003786605 6:9493918-9493940 CTCCACAGCATGTCTTCCCAAGG - Intergenic
1004084043 6:12426651-12426673 GTCCCCTGCTTGTCATCTCATGG - Intergenic
1006671536 6:35732286-35732308 GCCCCCAGCCTTTCATCTCTTGG + Intergenic
1007627415 6:43254371-43254393 GGTCACAGCCTCTCATCTGAGGG - Intronic
1017145068 6:151227398-151227420 GGCCAGGGGCTGTCATCTCAAGG + Intergenic
1018567686 6:165172867-165172889 CTCCACAGACCTTCATCTCAGGG - Intergenic
1018742401 6:166740120-166740142 GTCCACATCCTGTCTTCTAAGGG - Intronic
1021828208 7:24574367-24574389 ATCCACATCCTGTCACCACACGG - Intronic
1023564364 7:41508785-41508807 GTCCCAAGCCTGTCTTCACATGG + Intergenic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1034774341 7:153811149-153811171 CTCCACAGCCTTCCCTCTCATGG - Intergenic
1035325221 7:158061595-158061617 GTCCACAGCCAGTGTGCTCACGG - Intronic
1037492662 8:19410830-19410852 GCCCACAGCATGTAATTTCAGGG + Intronic
1038335779 8:26644173-26644195 CTCCACTGTCTGTCATTTCAAGG - Intronic
1038928757 8:32170006-32170028 GACCACTGCCTGTCTTCACATGG - Intronic
1041331494 8:56730634-56730656 GCCCTCATCCTTTCATCTCAGGG - Intergenic
1042937199 8:74071632-74071654 GTCCACTGCCTCTCACCTCCAGG + Intergenic
1045078725 8:98601090-98601112 TTCCTCAGCCTCTCAGCTCAGGG - Intronic
1048502248 8:134988841-134988863 TTCGACAGCCTCTCCTCTCATGG - Intergenic
1048665319 8:136654860-136654882 GTCCACAGCCTGTGATCTCCAGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1054724791 9:68639473-68639495 GCCCACAGCCTGTTATAACAGGG + Intergenic
1056598197 9:88025154-88025176 GTCCAGTGCCTGTTAGCTCACGG + Intergenic
1059240097 9:112796971-112796993 CTCCCCAGCCTGTGATCTGATGG + Intronic
1059254986 9:112921780-112921802 AGCCACAGCATGTTATCTCAAGG + Intergenic
1059296258 9:113273861-113273883 TTCCACAGCCTGAAATCCCAAGG + Intronic
1059403023 9:114082276-114082298 TGCCACAGCCTGTCCACTCAGGG + Intergenic
1060331615 9:122676546-122676568 GACCATAGCCTGTAGTCTCATGG - Intergenic
1186877806 X:13833940-13833962 GTACATAGCCTGCCCTCTCAGGG - Intronic
1189410655 X:40768047-40768069 GTCCATAGCCTGTTTTCTTAGGG + Intergenic
1190744468 X:53313809-53313831 GACCACAGCCTGACATGGCAGGG + Intronic
1192874258 X:75211360-75211382 GACCACGGCCTGCCTTCTCAGGG - Intergenic
1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG + Intronic
1198139936 X:133792443-133792465 GTCCATAGTCTTTCAACTCAGGG - Intronic
1199034349 X:143032982-143033004 GACCGCAGCCTGCCTTCTCAGGG - Intronic
1201355315 Y:13091565-13091587 TTCCACATACTGTTATCTCATGG - Intergenic