ID: 1050357091

View in Genome Browser
Species Human (GRCh38)
Location 9:4793359-4793381
Sequence GCGTCGCCTCCAAAGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050357086_1050357091 7 Left 1050357086 9:4793329-4793351 CCGGCGAGCGCGTCGGGGAGGGC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1050357091 9:4793359-4793381 GCGTCGCCTCCAAAGCCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050357091 Original CRISPR GCGTCGCCTCCAAAGCCGGA GGG Intronic
905229745 1:36507674-36507696 CCGTCTCCTCCAAATCCTGAGGG - Intergenic
908555672 1:65254605-65254627 GCGTGGCCTCCACAGCCGCCGGG - Intronic
1077002798 11:332998-333020 GTGTCTCCTCCCAAGCTGGAGGG - Intergenic
1092348864 12:7739511-7739533 GCGTCGTATGCAGAGCCGGAGGG - Intronic
1096992696 12:55818074-55818096 GCGCCGCGCCCATAGCCGGACGG + Exonic
1113747389 13:112754683-112754705 CCATCGCCTCCAAAGCCTGTGGG + Intronic
1114269739 14:21093350-21093372 GCGTCGCCTCGAGGGCCAGAAGG + Intronic
1119614754 14:76091716-76091738 GGCTCACCTCCAAAGCCAGATGG + Intergenic
1121751831 14:96363651-96363673 GCGTCGCGTCCCCATCCGGAAGG - Exonic
1132522564 16:398207-398229 GCGTCCCCTCCAGAGGAGGACGG + Intronic
1132598948 16:765433-765455 GCGTCCCCTCCACAGCCAGGGGG + Intronic
1132759303 16:1501099-1501121 CCGTCACCTCCACAGCCTGAAGG - Intronic
1141949318 16:87330540-87330562 GCCTTGGCTCCAAAGCTGGAGGG + Exonic
1142143018 16:88480888-88480910 GCCTCGCCATCAAAGCCGGGAGG + Intronic
1160777242 19:861962-861984 GCGTCTCCTCCCAGGCCTGAAGG - Intronic
1161920178 19:7260247-7260269 ACGTCGGCACCAAAGCAGGAGGG - Intronic
1167286950 19:48603681-48603703 GCGTCGCCTCCGCCGCCTGACGG - Exonic
948423507 2:237874575-237874597 GCGGCTCTTCCAAAGCAGGAGGG + Intronic
1172961816 20:38805587-38805609 GCGCTGCCTCCCAAGCCGGATGG + Intergenic
1179590914 21:42407279-42407301 GTGTCCTCTCCAAAGCAGGAGGG + Intronic
958814653 3:98901886-98901908 GGGACGCCTCCAAAGGCCGAAGG - Intergenic
961457099 3:127029679-127029701 GCGCAGCCTCCAGAGCTGGAGGG - Intronic
968622210 4:1608920-1608942 GCCCCGCCTCCAAACCCGCATGG - Intergenic
968983861 4:3865079-3865101 GCCCCGCCGCCACAGCCGGAAGG - Intergenic
969498483 4:7539703-7539725 GCGGGGCCTCCACAGCAGGAAGG - Intronic
973639353 4:52887655-52887677 GCGTGGCCACCAAAGCCAGAAGG + Intronic
976812485 4:89111542-89111564 GCGTCGCCGCCGGAGCCGGAAGG - Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1037820588 8:22132943-22132965 GCATGGGCTCCAAAGCGGGATGG - Intronic
1049251769 8:141593118-141593140 GCATGGCCTCCCAGGCCGGAGGG - Intergenic
1050357091 9:4793359-4793381 GCGTCGCCTCCAAAGCCGGAGGG + Intronic
1062212430 9:135372239-135372261 GCGTCTCCCCCACAGCAGGATGG - Intergenic
1198265415 X:135004244-135004266 GCTCCGCCCCCAAAGCCCGATGG - Intergenic