ID: 1050357708

View in Genome Browser
Species Human (GRCh38)
Location 9:4798684-4798706
Sequence GCCTATATTTTATTTCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050357703_1050357708 7 Left 1050357703 9:4798654-4798676 CCTAACTTGGATCCTTTAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1050357708 9:4798684-4798706 GCCTATATTTTATTTCGGCCTGG No data
1050357706_1050357708 -5 Left 1050357706 9:4798666-4798688 CCTTTAAAAGGAGGATGTGCCTA 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1050357708 9:4798684-4798706 GCCTATATTTTATTTCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050357708 Original CRISPR GCCTATATTTTATTTCGGCC TGG Intronic
No off target data available for this crispr