ID: 1050366208

View in Genome Browser
Species Human (GRCh38)
Location 9:4876090-4876112
Sequence TTAGTGGCCCAGAACTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050366208_1050366211 17 Left 1050366208 9:4876090-4876112 CCTTGATAGTTCTGGGCCACTAA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1050366211 9:4876130-4876152 CTACAAGAAAGAGAAAGAGGTGG No data
1050366208_1050366212 23 Left 1050366208 9:4876090-4876112 CCTTGATAGTTCTGGGCCACTAA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1050366212 9:4876136-4876158 GAAAGAGAAAGAGGTGGTGACGG No data
1050366208_1050366213 24 Left 1050366208 9:4876090-4876112 CCTTGATAGTTCTGGGCCACTAA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1050366213 9:4876137-4876159 AAAGAGAAAGAGGTGGTGACGGG No data
1050366208_1050366210 14 Left 1050366208 9:4876090-4876112 CCTTGATAGTTCTGGGCCACTAA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1050366210 9:4876127-4876149 AGTCTACAAGAAAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050366208 Original CRISPR TTAGTGGCCCAGAACTATCA AGG (reversed) Intronic
903422217 1:23226146-23226168 TAAGTGCCCCAGAAAAATCAGGG + Intergenic
910201009 1:84698609-84698631 TCAGTGGGCTAGAATTATCAGGG + Intergenic
911084294 1:93963661-93963683 TTATTGGCCCAAAACTGGCAGGG + Intergenic
913446037 1:118951769-118951791 TTAGTGTCCCAGCCCTATCTGGG + Intronic
914411375 1:147431515-147431537 TTAGTGAACCAGAAGTTTCAAGG + Intergenic
918878268 1:190080065-190080087 TTAGGGGCACTGAATTATCAAGG - Intergenic
1065926565 10:30439132-30439154 TTAGTGGCCAAGAGGTACCATGG + Exonic
1070676453 10:78415064-78415086 TTAGTGTGCCAGAACTACCCAGG + Intergenic
1070707358 10:78650066-78650088 TTAGTGGCAAAGAAATATCAAGG + Intergenic
1075563161 10:123483015-123483037 TCAGTGGTCCAGGACCATCAGGG - Intergenic
1086542926 11:87934088-87934110 TGAGTGGTCCAGGACAATCACGG - Intergenic
1089310950 11:117557789-117557811 TTAGGGGCCTAGATCTATCTAGG + Intronic
1090875964 11:130789357-130789379 TCAGTGGCCCAGGGCCATCATGG + Intergenic
1101333178 12:103773613-103773635 TTAGTTGAACAGAACAATCAAGG + Exonic
1112449094 13:99493233-99493255 TTATTTGCCCAAAACTCTCAGGG - Intergenic
1117496520 14:56310934-56310956 TCAGTGCCACAGAACTATCTGGG + Intergenic
1118125094 14:62893079-62893101 TTCTTTGCCCAGATCTATCAGGG - Intronic
1119021960 14:71123848-71123870 CTAGAGGTCCAGAACTCTCAAGG - Intergenic
1119177400 14:72579260-72579282 TTAGAGGCCCTGAACTATTCAGG - Intergenic
1122187571 14:100012949-100012971 ATAGTGGCCCAGAATTGTAATGG + Intronic
1124904354 15:33854794-33854816 GTAGTGGCCCAGGACTGACATGG - Exonic
1127428372 15:58878031-58878053 TGAGTGGCCCTCAACCATCATGG - Intronic
1131347289 15:91662192-91662214 TTAGTGGCCAAGAATCATTATGG - Intergenic
1132066522 15:98735502-98735524 GCAGTGGCCTAGCACTATCACGG - Intronic
1140043381 16:71424355-71424377 ACAGTGGCCCAGAACTAGCAGGG - Intergenic
1144789452 17:17849349-17849371 TTTGTGGCCCTGAGCCATCAAGG - Intronic
1148635337 17:49144749-49144771 TTAGAGGGACAGAACTAACAGGG + Intronic
1149165245 17:53743524-53743546 TTAGTGTCGTAGAACTAACATGG - Intergenic
1153587298 18:6635750-6635772 TTAGTAGCCCAGAAACATTAAGG - Intergenic
1157029663 18:43890299-43890321 TTATTTACCCAGAACTATCTTGG + Intergenic
1159083913 18:63765943-63765965 TTAGTGGCTCAAGGCTATCAGGG + Intronic
1166095090 19:40533376-40533398 TTAGTGGCCCAGAGCTACTTAGG - Intronic
928556889 2:32436119-32436141 CTAGTGGCCTTGATCTATCAGGG + Exonic
930871486 2:56175541-56175563 TGACTGGACAAGAACTATCATGG - Intergenic
931832876 2:66070878-66070900 TTAATTGCCCAGAACTATCGCGG + Intergenic
936469157 2:112782837-112782859 TGTGTGACCCACAACTATCATGG - Intronic
941334994 2:164230983-164231005 TTTTAAGCCCAGAACTATCATGG + Intergenic
944909517 2:204296120-204296142 TTAGTGGCCCTGCACAAGCATGG + Intergenic
1170967462 20:21087733-21087755 TTATGTGCCCAGAACTATAATGG + Intergenic
1171210955 20:23316570-23316592 TTAGTAGCCCAGAGATATCTGGG - Intergenic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1178373342 21:32046287-32046309 ACAGAGGCCCAGAACTACCAGGG + Intergenic
1180965595 22:19786592-19786614 GTAGAGGCCCAGAACCCTCAGGG + Exonic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
954611506 3:51946896-51946918 CTAGGGGCCCAGAACGATCGAGG + Intronic
955115307 3:55992678-55992700 TTATTTTCCAAGAACTATCAAGG + Intronic
957482412 3:80815920-80815942 TTAGTGTCCCAGTACTATGGTGG - Intergenic
957587201 3:82147527-82147549 TTAATGGCCTACAACTATAAAGG - Intergenic
959237628 3:103745266-103745288 TGAGTGGCCCAGAATCTTCAGGG - Intergenic
959614542 3:108332649-108332671 TTACTGGCTCAGAACGGTCAGGG - Intronic
961807512 3:129499958-129499980 TGACTGGGCCAGAAATATCAAGG + Exonic
965328657 3:167340968-167340990 GTAGTGGTACAGAAATATCAAGG + Intronic
967730934 3:192906164-192906186 TTTCTGGCCTAGGACTATCAGGG + Intronic
972157018 4:36176008-36176030 TTAGTTGCCCAGGAGTTTCAGGG - Intronic
973706331 4:53584497-53584519 CATGTGGCCCAGAACAATCAAGG + Intronic
978432190 4:108644367-108644389 TTAGTGGCTTAGACCTTTCAGGG - Intergenic
987056429 5:14197583-14197605 TTATTTGCCAAGAACTATGAAGG + Intronic
987449943 5:18070732-18070754 ATCAAGGCCCAGAACTATCAAGG + Intergenic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
989484979 5:41979135-41979157 TTTGTGGCCCACTACTCTCAAGG + Intergenic
990918732 5:60938672-60938694 TTAGTGGCCAAGAACAATTTTGG + Intronic
991017731 5:61949543-61949565 TTTGTGCCCCAGAACTCCCACGG + Intergenic
991945479 5:71894846-71894868 TTGGGGGCTCAGAACTAGCAAGG - Intergenic
995046915 5:107660877-107660899 TTAGTGACCCAGCACTAAGAGGG - Intronic
999466359 5:151809859-151809881 TTAATGGCCCAGCTCTACCAGGG + Exonic
1007157950 6:39764232-39764254 TTAGTGGCCCAGAAAAGTTAGGG + Intergenic
1008159722 6:48062363-48062385 TTAGTGGTTCAGAACCACCAAGG - Intronic
1008308339 6:49933753-49933775 TTGGTGGCCCCGCACTAGCAGGG + Intergenic
1008684679 6:53911846-53911868 CTAGGTGCCCAGAAATATCATGG - Intronic
1010157171 6:72808590-72808612 CTAGTGCCCCAGCACTTTCAAGG + Intronic
1013129484 6:107218516-107218538 TGAGTGGTCCAGTAATATCAAGG - Intronic
1018398678 6:163401363-163401385 CTAGAGGCACAGAGCTATCAGGG + Intergenic
1021430577 7:20554246-20554268 TCAGTGACTCAGCACTATCAAGG + Intergenic
1023626323 7:42118608-42118630 TTAGTGAAGCAGAACAATCAAGG - Intronic
1023626422 7:42119391-42119413 TTAGTGTAGCAGAACAATCAAGG - Intronic
1023660393 7:42465835-42465857 TTAGGGGCCCAAAACTATTTAGG - Intergenic
1023859259 7:44207563-44207585 TAATTAGACCAGAACTATCAGGG - Intronic
1027472104 7:78586250-78586272 TTAGTGTCTCAGAACTGACAAGG + Intronic
1031333383 7:120495484-120495506 TTACTGACCCAGAACTATGCAGG + Intronic
1035591659 8:820012-820034 TTAGTAGACAAGAACTCTCATGG - Intergenic
1040696312 8:50003882-50003904 TTACTGGCCCAAAACAATCTGGG + Intronic
1045834608 8:106505778-106505800 AAAGTGGCCCAAGACTATCAGGG + Intronic
1046681689 8:117177630-117177652 TTAATGGCCCAGAAAGATGAAGG + Intergenic
1050366208 9:4876090-4876112 TTAGTGGCCCAGAACTATCAAGG - Intronic
1058118386 9:101110571-101110593 TTAGTGGCCTGGATATATCATGG - Intronic
1061426337 9:130500676-130500698 TAAATGGCCCAGAACAAACAGGG + Intronic
1188781323 X:34289519-34289541 TTACTGACCCAGAACTTTCAAGG - Intergenic
1198679395 X:139165548-139165570 TCAGGGGCCCAGAGCTCTCAAGG + Intronic
1200770809 Y:7123614-7123636 TTAATGGCCCAACATTATCAAGG + Intergenic