ID: 1050366993

View in Genome Browser
Species Human (GRCh38)
Location 9:4881915-4881937
Sequence TCTTCCCCAGGATTGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050366993_1050367000 30 Left 1050366993 9:4881915-4881937 CCCTAGATCAATCCTGGGGAAGA 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1050367000 9:4881968-4881990 CACACACAAACCAATCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050366993 Original CRISPR TCTTCCCCAGGATTGATCTA GGG (reversed) Intronic
901940006 1:12654821-12654843 TCTTGCCCATGAATGATCAAAGG - Intronic
902665435 1:17934398-17934420 TCTTGCCCAGAAATGATCTGCGG + Intergenic
902810228 1:18883876-18883898 CCTTCCCCAGGAATGATGTTCGG + Intronic
909824512 1:80110598-80110620 TCTTTCCCAAGATTGATGTCCGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914220904 1:145681145-145681167 TATTCCCCAGCATTGTTCTTGGG - Intronic
914473477 1:148004020-148004042 TATTCCCCAGCATTGTTCTTGGG - Intergenic
915884933 1:159712546-159712568 TCTTCCCAAGGATTGAGTTATGG - Exonic
917813925 1:178688410-178688432 TCTTCCCCAGGAAAGACCTCCGG - Intergenic
919640736 1:200041630-200041652 TCTTCCCCAGTTTCGGTCTAGGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
923946628 1:238895247-238895269 TCTTTCCCTGAATTTATCTATGG - Intergenic
924269289 1:242316087-242316109 TATTCCACAGGATTTATGTAAGG + Intronic
1063114721 10:3066115-3066137 TTTTCCCCAGGATTGCCCTAAGG + Intergenic
1065652718 10:27910295-27910317 TTTTCCCTAGGAGTGATCTTTGG - Intronic
1066715612 10:38282680-38282702 TATTCCACAGGATTTATGTAAGG - Intergenic
1067773129 10:49141597-49141619 GCTTCCCGAGGATTGAACTTTGG - Intergenic
1071358211 10:84818941-84818963 TCTTCCCCAGGAGTGGTGGAGGG + Intergenic
1072843168 10:98797151-98797173 GTTTCTCCAGGATTGATCTCTGG - Intronic
1075653549 10:124146259-124146281 TCAACCCCAGCATTAATCTAGGG - Intergenic
1079686744 11:23368377-23368399 CATTCTCCAAGATTGATCTACGG - Intergenic
1079933434 11:26591943-26591965 TCCTTCCCAGGATGTATCTAGGG + Intronic
1081568196 11:44273051-44273073 TCTTCAGCAGCATTGTTCTAAGG - Intronic
1083100920 11:60305094-60305116 TTTTCCCCCGGATTGATGCAGGG - Intronic
1084727729 11:70952940-70952962 TGTTCCCCAGGAAGGCTCTAGGG + Intronic
1084869936 11:72091562-72091584 CCTTCCCCAGGGGTGAACTAGGG + Intronic
1085050597 11:73378093-73378115 TGTTCCCCAGGAGTGGTCTCTGG + Intronic
1085694169 11:78689877-78689899 CCTCCCCCAGAATTGATCTTAGG - Intronic
1086755524 11:90557662-90557684 TTTTCCCCAGGATAGCTCCAGGG - Intergenic
1092616620 12:10221781-10221803 TCTTCCTCATGATTGTCCTAGGG - Exonic
1093317593 12:17669659-17669681 TGTTCCTCAAGATTGATCTCTGG - Intergenic
1097262988 12:57729903-57729925 GCATCCCCAGGAATGATCAAGGG - Intronic
1097404099 12:59167507-59167529 TATTCCCCAGGTGTTATCTAGGG - Intergenic
1098285365 12:68901724-68901746 TCTTCCTCAGGATTGGACTTTGG + Intronic
1099605552 12:84797588-84797610 TCCTTCCCAGGATATATCTAGGG - Intergenic
1106069082 13:26389618-26389640 TGTTCCCCAAGACTGATCTTGGG - Intronic
1106723191 13:32456355-32456377 TCTTCCTAAGGATGTATCTATGG - Intronic
1106821326 13:33467814-33467836 TCATCCCCAGGTTTGCTTTAAGG + Intergenic
1107025980 13:35801983-35802005 TCTTCTCCAGGATTGAGCTCTGG + Intronic
1107137236 13:36957896-36957918 TCCTTCCCAGGATGTATCTAGGG - Intronic
1114723614 14:24910004-24910026 TCTACCACAGGATTGTTTTAAGG + Intronic
1115903745 14:38184077-38184099 ACTTTCCCAGGATTGATGTCTGG - Intergenic
1116107546 14:40529433-40529455 TTTTCCCCAGGATTACTCTGGGG + Intergenic
1116446941 14:45021710-45021732 TCCTTCCCAGGATGTATCTAGGG + Intronic
1121657188 14:95605623-95605645 CCTACCCCAGGAGTTATCTAAGG - Intergenic
1124052827 15:26214910-26214932 CCTTCCCCAAGCGTGATCTATGG + Intergenic
1126115249 15:45202012-45202034 TCTCTCCCAGGAATGATCTCGGG - Intergenic
1127073772 15:55307093-55307115 TCCTCCCCAGGATGTGTCTAGGG + Intronic
1127196624 15:56592407-56592429 GTTTCCCCAGGATTGATCCCTGG - Intergenic
1127282639 15:57504947-57504969 CCTTCCCCAGGACTGCTCTAGGG - Intronic
1135112988 16:19705095-19705117 TCTTCCTCTGGAATGTTCTAGGG + Exonic
1140851974 16:78943566-78943588 TGTTTCCCAGGACTGATCAATGG - Intronic
1146058871 17:29594118-29594140 TCTTCCCCATTCTTGACCTATGG - Intronic
1146304355 17:31719351-31719373 TTTTCCTCAGAATTGATTTATGG - Intergenic
1146997577 17:37334434-37334456 TCCTTCCCAGGATGTATCTAGGG - Intronic
1147266081 17:39235811-39235833 TCTTCCCCAGGAGAGACTTAAGG + Intergenic
1155297198 18:24396473-24396495 TCTTCTCCAGCATTGAGCAACGG - Intronic
1155387094 18:25290307-25290329 TACTCCCCAAAATTGATCTAAGG + Intronic
1156867215 18:41902431-41902453 TCTTCCCTAGGTTTTATGTATGG - Intergenic
1158840002 18:61375217-61375239 TAATCTCCAGGATTTATCTATGG + Intronic
1159051004 18:63421504-63421526 CCATCCCCAGAATGGATCTAGGG - Intronic
1163662100 19:18584461-18584483 TCCTTCCCACGATGGATCTAGGG - Intronic
1165856414 19:38881289-38881311 TTCTCCCCAGGATGGATCTGGGG + Intronic
926787539 2:16533124-16533146 TCTTCCCCTGGGTTGAGCCATGG - Intergenic
927381898 2:22489096-22489118 TCTCTACCAGGATTCATCTATGG - Intergenic
929441917 2:41971429-41971451 TCTTCCCCTGGATTCAACCAGGG - Intergenic
933522302 2:83389282-83389304 TCTTTCCCAGGATTGCTGTCCGG - Intergenic
943459934 2:188159982-188160004 TCTTCCCAAGGAATCATCAATGG + Intergenic
945576826 2:211541546-211541568 TTTTCCCCAGGGTTGAGCTTTGG - Intronic
946583476 2:221157228-221157250 GCATGCCCAGGATTGTTCTAGGG + Intergenic
1169641432 20:7756808-7756830 TCCTCCCCAGAATAGATCTTAGG - Intergenic
1172882504 20:38211148-38211170 ACTTCCCCAGGTGTGGTCTAGGG - Exonic
1173834028 20:46113451-46113473 TCCTCCCCAAGATTGCTGTATGG - Intergenic
1174138379 20:48396146-48396168 TCTTCCCCAAGATTGCTCAGAGG + Intergenic
1174735201 20:52959614-52959636 TCTTCTCCAGGACTTTTCTAAGG + Intergenic
1175023525 20:55876853-55876875 TCTTCCCCAAAACTGATCTCTGG - Intergenic
1182078995 22:27515758-27515780 TCTTCCCCAGGAATCATCCTGGG - Intergenic
1182311613 22:29412641-29412663 TCTTCCCCAGGACTGAGCTCTGG - Intronic
1182688729 22:32141194-32141216 TCTTCCCCAGGACTGAGCTCTGG + Intergenic
1183035508 22:35138229-35138251 TCTTCCCCAGGATAGGTCTGGGG + Intergenic
1183429172 22:37755443-37755465 TCCTTCCCAGGATGCATCTAAGG - Intronic
952222127 3:31333263-31333285 GCTTCTCCAGGATTGATCCCTGG - Intergenic
953122447 3:40058168-40058190 TTTTTCCCAGCATTGACCTAAGG + Intronic
955672916 3:61420768-61420790 TCTTCACCAGCATTGAACTGTGG + Intergenic
955898426 3:63725922-63725944 CCTTCCCCAGGATGGAGATATGG + Intergenic
961143263 3:124573446-124573468 TCATCCCCAGGATTGTTCAAGGG + Intronic
962223849 3:133587785-133587807 CCCTCCCCAGGATTCTTCTAAGG + Intronic
963391661 3:144672755-144672777 TCTTCTCAAGAATTGATCAATGG + Intergenic
964781117 3:160338858-160338880 TCTTCTCCAATATTGTTCTAGGG - Intronic
977020635 4:91754881-91754903 TCTTCCAGAGGTTTGATGTAGGG - Intergenic
977601223 4:98935793-98935815 TCTTCCCCCAAAATGATCTATGG + Intergenic
978165717 4:105604015-105604037 TCTTCCCCAGGATGTCTCCATGG - Intronic
978495964 4:109359246-109359268 TCTTCCCCATGATTGTTGTGTGG - Intergenic
980172271 4:129304877-129304899 TTTTCTCCAGGATTGGTCTCTGG + Intergenic
980872284 4:138624427-138624449 TCCTTCCCAGGATGTATCTAGGG + Intergenic
980970532 4:139563046-139563068 TTTTCCCAAGAATTGATCTATGG - Intronic
981956724 4:150483708-150483730 TTTTCTCCAGAATTGATCTGAGG - Intronic
989519990 5:42390265-42390287 TCTTGCCCATGAGTGATCAAAGG - Intergenic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
992485305 5:77189110-77189132 TCTTCCCCAGGCTTGAAATCTGG + Intergenic
993002576 5:82396389-82396411 TATTCCCCAGTAGTGATCTAAGG - Intergenic
995125894 5:108576779-108576801 TCCTTCCCAGGATGTATCTAGGG + Intergenic
996807015 5:127467478-127467500 TCTTCCTCAGCATTCATCTTAGG + Intergenic
998894380 5:146783233-146783255 TCATCCCCAGGTTTAATTTATGG + Intronic
999364021 5:151009669-151009691 TGGTCCCCAGGATAGGTCTATGG - Intergenic
999807180 5:155092991-155093013 TCTTCCCCATGATTCCTGTAAGG + Intergenic
1005413237 6:25573124-25573146 TCTTCCCCAGGGATGACCAAGGG + Intronic
1005718289 6:28574604-28574626 TCTTCCCCTGCTTTCATCTACGG + Intronic
1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG + Intronic
1007813494 6:44503450-44503472 TCTACCTCATGATTCATCTAGGG + Intergenic
1009301818 6:62032875-62032897 GTTTCTCCAGGATTGATCTTTGG - Intronic
1011033359 6:82945672-82945694 TCTCCACCAGGATTGATCCCTGG - Intronic
1011189257 6:84713201-84713223 TCCTTCCCAGGATGTATCTAGGG + Intronic
1014542268 6:122691672-122691694 TTTTCCCCAGGATTGGTCCCTGG + Intronic
1016063513 6:139655159-139655181 TATTGCCCAGGGTTGTTCTAAGG - Intergenic
1017180988 6:151551725-151551747 TCCTCCCCAGGATTGACCAGGGG - Intronic
1019909908 7:4093927-4093949 TTTTCCCCAGGATTCACCTCTGG - Intronic
1020492942 7:8811616-8811638 TCTTCCCCAAAATTGAGCAAAGG + Intergenic
1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG + Intronic
1023163001 7:37315892-37315914 TGTTACTCAGGATTTATCTAAGG - Intronic
1027421498 7:78021281-78021303 TCTTCCACAGAATTGGTATATGG + Intronic
1027776668 7:82473632-82473654 TCTTCCCCCAGATTGCTGTATGG - Intergenic
1027863249 7:83612439-83612461 TTTTCCATAGGATTGATCTTTGG - Intronic
1028588051 7:92470592-92470614 TCCTTCCCAGGATGTATCTAGGG + Exonic
1028960380 7:96742247-96742269 TCTTCCCAAGGGTTGATAAAGGG + Intergenic
1030138807 7:106284868-106284890 TCTGCCGCAGGATTCATCTCGGG + Exonic
1033606851 7:142933817-142933839 TCTTCCCCAGGGTGGTTCTGTGG - Intergenic
1040671806 8:49700746-49700768 TATTCTCCAGGATTCCTCTAAGG + Intergenic
1043733854 8:83720046-83720068 TCTGCCCCAGGATTCATTTTAGG + Intergenic
1044323007 8:90826426-90826448 TCTTCCCCAGTAGCGATTTAAGG - Intronic
1046869871 8:119194117-119194139 TCTTCCCCTGGCATGATCGAGGG + Intronic
1049229908 8:141476625-141476647 TTTTCTCCTGGATTGTTCTAGGG + Intergenic
1050366993 9:4881915-4881937 TCTTCCCCAGGATTGATCTAGGG - Intronic
1051222412 9:14863591-14863613 TCTTCCCTAGGATTCTTCTGTGG - Intronic
1054931400 9:70639219-70639241 TCTGCCCCAGGGTCTATCTATGG + Intronic
1058497473 9:105575731-105575753 TCTTCCCCATGATTGTTTTTAGG - Intronic
1058545194 9:106053763-106053785 TCTTCCCCTGGATTTGTCTTTGG + Intergenic
1059041943 9:110823795-110823817 GTTTCCCCAGGATTGATCCCTGG - Intergenic
1059075806 9:111192807-111192829 ACTTCCCCAGTGCTGATCTAAGG - Intergenic
1186604209 X:11072283-11072305 TTTTTCCCAGGTCTGATCTAAGG - Intergenic
1189058210 X:37722839-37722861 TCTTCCCCAGAATTCCTCTTAGG - Intronic
1189946832 X:46188485-46188507 TCCTTCCCAGGATGTATCTAGGG - Intergenic
1192048319 X:67699942-67699964 TCCTCCCTAGGAATGATCCATGG + Intronic
1193528853 X:82628223-82628245 TTTTTTCCAGGATTGATCTCTGG - Intergenic
1194990914 X:100545308-100545330 TTTTCTCCAGGATTGGTCTCTGG - Intergenic
1195081420 X:101375072-101375094 TCTTCCCCAAGAAAGATCTAAGG + Intronic
1197954282 X:131929958-131929980 TCCTTCCCAGGATGTATCTAAGG + Intergenic
1199527113 X:148805118-148805140 TTATCCCCATGATTGATTTATGG - Intronic
1200849281 Y:7866081-7866103 TATTCCTCAAGATTGGTCTATGG - Intergenic