ID: 1050367593

View in Genome Browser
Species Human (GRCh38)
Location 9:4886913-4886935
Sequence TGCCACAGAATCACCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050367593_1050367598 19 Left 1050367593 9:4886913-4886935 CCTGGCCGGGTGATTCTGTGGCA No data
Right 1050367598 9:4886955-4886977 CTCTTTCAGTACTGACTGAGTGG 0: 3
1: 47
2: 113
3: 98
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050367593 Original CRISPR TGCCACAGAATCACCCGGCC AGG (reversed) Intergenic
No off target data available for this crispr