ID: 1050371623

View in Genome Browser
Species Human (GRCh38)
Location 9:4927691-4927713
Sequence CTCTTTTACCACTTCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050371623_1050371624 19 Left 1050371623 9:4927691-4927713 CCTCTCATGAAGTGGTAAAAGAG No data
Right 1050371624 9:4927733-4927755 AAATCTCGCTAAATTATTTTTGG No data
1050371623_1050371625 25 Left 1050371623 9:4927691-4927713 CCTCTCATGAAGTGGTAAAAGAG No data
Right 1050371625 9:4927739-4927761 CGCTAAATTATTTTTGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050371623 Original CRISPR CTCTTTTACCACTTCATGAG AGG (reversed) Intergenic
No off target data available for this crispr