ID: 1050374910

View in Genome Browser
Species Human (GRCh38)
Location 9:4960650-4960672
Sequence CTGGGGAAACTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050374910_1050374914 -7 Left 1050374910 9:4960650-4960672 CCCTCCTGCTTCAGTTTCCCCAG No data
Right 1050374914 9:4960666-4960688 TCCCCAGTAGCTAGGACTACAGG 0: 202
1: 8869
2: 121917
3: 246829
4: 246312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050374910 Original CRISPR CTGGGGAAACTGAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr