ID: 1050377151

View in Genome Browser
Species Human (GRCh38)
Location 9:4985172-4985194
Sequence CGGTGTGGCCCCGGAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050377146_1050377151 -6 Left 1050377146 9:4985155-4985177 CCGCGGCGTTGAGAAGACGGTGT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG 0: 1
1: 1
2: 1
3: 23
4: 198
1050377143_1050377151 4 Left 1050377143 9:4985145-4985167 CCAGTGTCGCCCGCGGCGTTGAG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG 0: 1
1: 1
2: 1
3: 23
4: 198
1050377145_1050377151 -5 Left 1050377145 9:4985154-4985176 CCCGCGGCGTTGAGAAGACGGTG 0: 1
1: 0
2: 0
3: 13
4: 576
Right 1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG 0: 1
1: 1
2: 1
3: 23
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050377151 Original CRISPR CGGTGTGGCCCCGGAGAGGG TGG Intronic
900102203 1:966657-966679 TGGCTTGGCCCCGGAGCGGGTGG - Intronic
900253421 1:1683711-1683733 GGGTGGGGCCCTGGAGAGCGGGG - Intronic
900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG + Exonic
900799082 1:4726604-4726626 CTGTGTGGCCCTAGTGAGGGTGG + Intronic
900991891 1:6101951-6101973 CAGGGTGGCCCCGGCGGGGGCGG - Exonic
900999623 1:6142319-6142341 TGGAGTGGCCCTGGAGAGAGAGG + Exonic
902383833 1:16065269-16065291 CTGCGTGGCCCCGGGGAGAGTGG - Intronic
902385932 1:16075963-16075985 AGGTCTGGCCTTGGAGAGGGTGG + Intergenic
902741388 1:18440987-18441009 CTGTGTGGCCCTGCAAAGGGTGG + Intergenic
902990693 1:20185560-20185582 CAGTGTGGCCCCGGAGTGGGAGG + Intergenic
903071608 1:20729590-20729612 CGGTGTGGCCAAGGACAAGGAGG - Intronic
906488031 1:46246943-46246965 CGGTTTGGCCTTGGAGAGGAAGG + Intergenic
907242331 1:53087740-53087762 CGGTGTGAGCCCGGTGAGGGCGG - Exonic
908702217 1:66913895-66913917 CGGTGTGAACCCGGAGCAGGCGG + Intronic
908796296 1:67833569-67833591 CGTTGTGGCCCCGCAGGAGGAGG + Intergenic
915552248 1:156642039-156642061 GGGGGCGGCCCCGGGGAGGGCGG + Exonic
916811893 1:168312949-168312971 TGGGGTGGCCCAGGAGCGGGTGG + Exonic
916991485 1:170250221-170250243 CGGTGTGGACCCAAAGAGTGAGG + Intergenic
920069389 1:203291287-203291309 GGGTGTGGCCCGGGAAAGGCAGG - Intergenic
922697069 1:227735956-227735978 CGGTGGGGACCTGGAGAGGACGG + Intronic
924610834 1:245572415-245572437 GGGTGTGGCCCCGGGAAAGGTGG + Intronic
1063662283 10:8043148-8043170 CGGGGTGGCCCGGGGGACGGAGG + Intergenic
1067796858 10:49327149-49327171 CAGGGTGGGCCAGGAGAGGGAGG - Exonic
1070540534 10:77412355-77412377 TGGAGTGGCCAGGGAGAGGGTGG - Intronic
1076778682 10:132711850-132711872 AGGTCTGGACCCAGAGAGGGAGG + Intronic
1076794115 10:132790537-132790559 CCGAGTGGCCCAGGACAGGGAGG + Intergenic
1077409169 11:2395519-2395541 CGGTGCGGCCCCGGGGGGCGAGG + Exonic
1078822126 11:14892538-14892560 AGGTCTGGCCCCAGAGAGGCAGG - Intergenic
1081665935 11:44917157-44917179 CGGGGGAGCCCAGGAGAGGGAGG + Intronic
1082814199 11:57497595-57497617 TGCTGTGGCCCAGGAGAGAGGGG + Intronic
1083488017 11:62995677-62995699 GGGTGTGGGCAGGGAGAGGGGGG + Intronic
1084589030 11:70079451-70079473 GGGTCTGGCCCTGGGGAGGGTGG - Intronic
1085268145 11:75249940-75249962 CAGTGTGGGACCAGAGAGGGGGG - Intergenic
1085470503 11:76754326-76754348 CAATGTGGCCCAAGAGAGGGAGG - Intergenic
1086498064 11:87424509-87424531 TGGTGTGGTCCCTGAGAGGGAGG - Intergenic
1089052501 11:115557794-115557816 TGGTGTGGCTCCGCAGAAGGTGG - Intergenic
1090825383 11:130381493-130381515 CGGTGGAGCCCAGGAGGGGGTGG + Intergenic
1095596135 12:43960276-43960298 CAGGGAGGCCCTGGAGAGGGGGG + Intronic
1097176522 12:57146623-57146645 CGCTGAGGCCACGGAGAGTGAGG - Intronic
1097264108 12:57736189-57736211 GGGTTTGGCTCCGGAGCGGGTGG - Intronic
1102694241 12:114785753-114785775 CGGGGTGGGTCGGGAGAGGGTGG - Intergenic
1103954036 12:124566935-124566957 CGGTGTAGCCCCGGACCTGGCGG - Intronic
1104643375 12:130481184-130481206 GGGTGTGGCCCCGCAGGAGGAGG + Intronic
1104842153 12:131830379-131830401 CGGTGTCCAGCCGGAGAGGGAGG + Intronic
1104941392 12:132397195-132397217 AGGAGGGGCCCCGGGGAGGGCGG - Intergenic
1104941411 12:132397256-132397278 AGGAGGGGCCCCGGGGAGGGCGG - Intergenic
1104941465 12:132397439-132397461 AGGAGGGGCCCCGGGGAGGGTGG - Intergenic
1104941518 12:132397618-132397640 AGGAGGGGCCCCGGGGAGGGTGG - Intergenic
1104941537 12:132397679-132397701 AGGAGGGGCCCCGGGGAGGGTGG - Intergenic
1104941557 12:132397740-132397762 AGGAGGGGCCCCGGGGAGGGCGG - Intergenic
1104941592 12:132397885-132397907 AGGAGGGGCCCCGGGGAGGGCGG - Intergenic
1105788336 13:23771166-23771188 GGGTGTGGCCACGGTCAGGGTGG - Intronic
1106033714 13:26025329-26025351 CTGCGTGGCCCTTGAGAGGGAGG - Exonic
1108088327 13:46818725-46818747 AGGGGAGGCCCTGGAGAGGGTGG - Intergenic
1108373228 13:49791915-49791937 CGGTGGCGGCCCGCAGAGGGGGG - Intronic
1110278005 13:73661240-73661262 TGGTGTGGCCTCGGAGAGAGGGG - Intergenic
1111097423 13:83534097-83534119 CAGGGTGGACCCGGAGAGGGAGG - Intergenic
1112336863 13:98523391-98523413 GGGTGTGGACCCAGAGAGGTGGG - Intronic
1118224219 14:63884022-63884044 TGGTGTGGCCCAGGAGATGAAGG + Intronic
1122961602 14:105096418-105096440 GGGTGTGGCCCCTGGGATGGGGG - Intergenic
1124577616 15:30923654-30923676 CAGCCTGGCCTCGGAGAGGGAGG - Intronic
1124904741 15:33857943-33857965 CGGGGTGGCCCCGCAGTGGGTGG - Intronic
1125062157 15:35437522-35437544 CGGTTTGCACCAGGAGAGGGAGG - Intronic
1125516711 15:40324650-40324672 CCGGCTGGCCCCGGAGCGGGAGG + Intergenic
1128087274 15:64894804-64894826 AGGTGTGGCCCTGCAGAGAGAGG + Intronic
1128256329 15:66199703-66199725 TGGTTTGGCCCAGGAGATGGAGG + Intronic
1129586862 15:76876082-76876104 CGGAGTGGCCCCGGGCAGTGAGG - Intronic
1129851528 15:78796561-78796583 CTGTGTGGGCCAGGAGCGGGTGG - Intronic
1132466458 16:79578-79600 CGGTATGGGCCCGGAGTGGTGGG - Exonic
1132689085 16:1174501-1174523 GGGTGTGGCCATGGGGAGGGAGG + Intronic
1134426739 16:14156107-14156129 GGCTGTGGCCCCTGAGAGGAGGG - Intronic
1138316967 16:56078521-56078543 CGGGCTGTCCCCAGAGAGGGTGG - Intergenic
1139160956 16:64507969-64507991 AGGTATTGCCCCAGAGAGGGAGG - Intergenic
1140468902 16:75204058-75204080 CTGTGTGGCCCAGGGGAGGTGGG - Intergenic
1141314146 16:82944536-82944558 CAGTGTGGACCAGGAGTGGGAGG + Intronic
1142049152 16:87946784-87946806 TGGCCTGTCCCCGGAGAGGGTGG + Intergenic
1142284646 16:89166810-89166832 AGCTGTGGTCCCGGAGAGAGTGG - Intergenic
1142411742 16:89920517-89920539 CGGAGTGTCCCAGGAGTGGGCGG - Exonic
1143731459 17:8885124-8885146 AGGTGGGGCCCTGGAGAGGCAGG - Intronic
1143780548 17:9226567-9226589 CTGAGTGCCCCAGGAGAGGGCGG - Intronic
1145007248 17:19344700-19344722 CGGAGAGGCCGCGGGGAGGGCGG - Intronic
1146370966 17:32265677-32265699 CGGCGCGGCCCGGGAGCGGGAGG - Intergenic
1147971538 17:44220993-44221015 CGGGGTGGCCCGGGAGGCGGCGG - Intronic
1149461828 17:56834696-56834718 CGGTTTGGCCCCGGAAAGGCAGG + Intronic
1150219943 17:63490473-63490495 CCGTGGGCCCCCGGCGAGGGGGG + Intronic
1155928943 18:31685579-31685601 CGGTGGGGCCCCGGTGCGGCGGG - Intronic
1157312201 18:46560698-46560720 AGGTGTGGCCGGAGAGAGGGAGG - Intronic
1158677066 18:59529618-59529640 CTGTGTGGCTCCTGAGTGGGTGG + Intronic
1160760355 19:781084-781106 CTGTGGGGCCCCGGAGGGGCGGG + Intergenic
1160782867 19:885539-885561 CGCTGTGGCCACGAAGCGGGAGG + Intronic
1160905564 19:1450226-1450248 CGGGGTGGCCTCGGAGCGCGCGG - Intronic
1161051283 19:2165093-2165115 CGGCGTGGCCCCTGAGGAGGCGG + Intronic
1161175808 19:2841666-2841688 GGGGGCGGCCCCGGCGAGGGCGG + Intronic
1161175988 19:2842154-2842176 CGGTGGGGCCTCGGCGGGGGCGG + Intronic
1161299511 19:3536025-3536047 CGGTGGGGACGTGGAGAGGGTGG + Intronic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1161888819 19:7019095-7019117 GGGTGTGGCCCCGCAGTTGGGGG - Intergenic
1161925225 19:7294439-7294461 GGGAGAGGCCCAGGAGAGGGAGG + Intergenic
1162109210 19:8390941-8390963 GGGTGGGGCCCGGGAGAGGCGGG + Intronic
1162231646 19:9271290-9271312 AGATGGGGCCCTGGAGAGGGTGG - Intergenic
1163432496 19:17276627-17276649 GGGTGAGGCCTGGGAGAGGGAGG + Intronic
1164643638 19:29843523-29843545 CAGGGTGGCCCCGGAGGAGGGGG + Intergenic
1164792837 19:31002696-31002718 CCGTGTGGCCCCGGAGAGTCAGG + Intergenic
1165157768 19:33798129-33798151 AGGGGTGGCCCCGGAGAGGCAGG - Intronic
1165914203 19:39247903-39247925 CGGTGAGGCCCGGGAGTGGGCGG - Intergenic
1166455850 19:42938828-42938850 CGAAGTGACCCCGGTGAGGGTGG + Intronic
1166745396 19:45139681-45139703 CAGTGTGGCAGCTGAGAGGGTGG + Intronic
1166809880 19:45508527-45508549 CTGCGCGGCCCTGGAGAGGGAGG + Intronic
1166885986 19:45961147-45961169 CTGTGTGCCCCCGCAGAGGAAGG - Exonic
1167309579 19:48729237-48729259 CGGCGTGGCCCCGGGGCGCGCGG + Exonic
1167630824 19:50625433-50625455 CGACGTGGCCCCCGAGAGCGTGG - Exonic
1168185254 19:54696331-54696353 GGGTGTGGCCCCTCAGAGGCTGG - Intronic
1168340836 19:55622185-55622207 CGGGGTGGCCCCGGAGAGGGCGG - Exonic
925927702 2:8682003-8682025 GCGTGTGGCCCCGGCGAGTGCGG + Exonic
927702564 2:25277308-25277330 CGGGGAGGCCCCGGACAGGCTGG - Intronic
929425484 2:41840797-41840819 TGCTGTTGCCCCGCAGAGGGCGG - Intergenic
934754609 2:96816508-96816530 CTGGGTGGCCCCGGAGGGGGCGG + Exonic
934781385 2:96971804-96971826 GGGCGTGGCTCAGGAGAGGGTGG + Intronic
936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG + Intergenic
937967676 2:127526272-127526294 CGGTGTGACCCCGGATGGCGCGG + Exonic
938100161 2:128493062-128493084 CGGTGCGCCCGCGGAGGGGGCGG - Intergenic
938500582 2:131829792-131829814 CCGTGTTGCCCCGCCGAGGGCGG - Intergenic
947049988 2:226031219-226031241 CCGTGCGGCCGGGGAGAGGGCGG - Intergenic
948542462 2:238700393-238700415 CGGTGTGGCACAGGAGAATGAGG + Intergenic
949047426 2:241878137-241878159 CGGAGTGGGCCGGGAGAGGGAGG - Intergenic
1171972505 20:31573121-31573143 AGGTGTGGCCGCGGCGGGGGTGG - Intronic
1172176826 20:32977560-32977582 AGGTGAGGACCCGGTGAGGGAGG - Intergenic
1175859438 20:62142714-62142736 AAGTGTTGCCCCGGAGCGGGTGG + Intronic
1175888216 20:62303997-62304019 AGGTGTGGCCCTGGAGAGCCCGG + Intronic
1175888234 20:62304068-62304090 AGGTGTGGCCCTGGAGAGCCTGG + Intronic
1179982392 21:44903182-44903204 GGGTGTGGCCCCTGGCAGGGAGG + Intronic
1180159497 21:45992745-45992767 CAGGGTGGCCCTGGAGAGAGAGG + Exonic
1181234883 22:21442856-21442878 CGGTGAGGCGCAGGGGAGGGGGG + Exonic
1181265797 22:21629867-21629889 CGGTGCGGCCACGGAGAGCGCGG - Exonic
1182741031 22:32567625-32567647 CTGTGTGGTCGGGGAGAGGGTGG + Intronic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1184155208 22:42662586-42662608 CGGGGAGGCCCGGGAGCGGGAGG + Intergenic
1184251609 22:43263558-43263580 CGGTGTGTCCCGGGGGAAGGAGG - Intronic
1184523255 22:45007896-45007918 CGGAGGGGGCCCGGAGGGGGGGG + Intronic
1184645363 22:45892137-45892159 GGGTGTGGCCAAGGAGATGGAGG - Intergenic
1185030042 22:48437812-48437834 CGGAGGGTCCCCAGAGAGGGTGG - Intergenic
1185060110 22:48602276-48602298 GGGGGTGGCCCCGGAAAGGTGGG - Intronic
1185299460 22:50072018-50072040 GGGTGTGGCCCTGGCCAGGGAGG + Intronic
951462568 3:22967225-22967247 TGGTGTGGCTGCGGAGAGGCAGG - Intergenic
953750861 3:45607442-45607464 CGCTGTGTCCCCGGGGAGTGAGG + Intronic
953793607 3:45966732-45966754 CGATGAGGCCCAGCAGAGGGAGG - Exonic
958027475 3:88065808-88065830 CGCTTTAGCCCCGGACAGGGAGG - Intronic
961649317 3:128409627-128409649 GAGTGTGGCCCCGGTGAGCGTGG + Intergenic
961743274 3:129046959-129046981 CGGAGGGGCCCCGGAGCGGGAGG - Intergenic
967184118 3:186930759-186930781 CGGCGTGGGCGCGGAGCGGGCGG + Exonic
968508870 4:986671-986693 CGCTGAAGCCCCGGAGATGGAGG + Intronic
968756284 4:2417991-2418013 CGTTGTGGCCCTGGATAGAGGGG + Intronic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
972437072 4:39044855-39044877 CCGGGTGGCCCCGGAGGGGGCGG - Intergenic
978964521 4:114725296-114725318 GGGTGAGGCCCTGGAGAGGGTGG + Intergenic
985966532 5:3342504-3342526 TGGTGTGGCCCAGGACAGGAGGG - Intergenic
995132121 5:108641893-108641915 TGGTGGGGACCAGGAGAGGGAGG - Intergenic
997584108 5:135034481-135034503 CGGTGTGTCACCGGGGAAGGAGG - Intronic
998018738 5:138753106-138753128 GGGAGTGACCCCTGAGAGGGAGG - Intronic
998179214 5:139924787-139924809 CAGCGAGGCCCCGGAAAGGGAGG - Intronic
1001293787 5:170484873-170484895 GGGTGTGGCTACAGAGAGGGAGG - Intronic
1001759084 5:174192785-174192807 CTGGGTGGCCCCCAAGAGGGAGG + Intronic
1002718161 5:181241629-181241651 TGGTGGTGCCCCTGAGAGGGAGG + Exonic
1005913355 6:30329713-30329735 CGGTGTGGGCCCGGTGGGTGTGG - Exonic
1006090715 6:31627147-31627169 CGGCGGGGCCCCGGTGAGGTGGG - Exonic
1006405808 6:33844171-33844193 TGGAGTGGACCCGGAGAGGGTGG - Intergenic
1006642437 6:35496319-35496341 CCGTGTGTCCCCTGAGAGGCAGG - Intronic
1007138801 6:39550386-39550408 AGGTGTGCCCCAGGAGTGGGAGG + Intronic
1007378226 6:41470590-41470612 CGCTGGCGCCCCGGAGACGGCGG - Intergenic
1013060565 6:106629722-106629744 CGCTGAGGCCCCCGGGAGGGCGG + Intronic
1014078368 6:117263526-117263548 GGGTGTGGCCCCGGAGGGTCCGG - Intergenic
1014551872 6:122798452-122798474 AGGTGTGGTGGCGGAGAGGGAGG - Intronic
1016386789 6:143537176-143537198 AGATGTGGACCCGGAGCGGGCGG - Intronic
1016461892 6:144286408-144286430 GGGTGGGGCTCCGGAGAGTGTGG + Intronic
1019410231 7:903657-903679 TGGTGTGGCGGCGGGGAGGGTGG - Intronic
1019421697 7:953965-953987 CGAGGTGGCCCCGGAGCCGGCGG + Intronic
1019456530 7:1130555-1130577 GGGGGTGGCCCTGGGGAGGGTGG - Intronic
1019564620 7:1673268-1673290 TGGGGTGGGGCCGGAGAGGGTGG + Intergenic
1024526727 7:50355473-50355495 TGGTGTGGCCCTGCAGAGCGGGG - Intronic
1034652952 7:152706586-152706608 AGGTGTGGCCCCTGAGGGGGTGG + Intergenic
1035078398 7:156196655-156196677 CGGTGTGGCCTCGGCCAGTGCGG + Intergenic
1035300017 7:157891057-157891079 AGGTGTGACCCAGGAGAGGACGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035362721 7:158324207-158324229 CGGTGTCACCGGGGAGAGGGTGG - Intronic
1035437158 7:158867733-158867755 CGGGGAGGCCCAGGAGAGGCCGG - Intronic
1037821445 8:22137121-22137143 TGGAGTGGCCCCAGAGAGTGTGG - Intergenic
1037822556 8:22141946-22141968 CAGTGTAGCCCCGGAGGGGGCGG + Exonic
1038152663 8:24956549-24956571 CGGTGGGAGCCCGGAGAGAGAGG + Exonic
1039608604 8:38901734-38901756 GGGTGGGGCCGCGGAGAGGGTGG + Intronic
1041872410 8:62649782-62649804 AGGTGAGGCCCAGAAGAGGGTGG - Intronic
1045516486 8:102864428-102864450 GGGTGTGGGCCGAGAGAGGGAGG + Exonic
1049018345 8:139937308-139937330 GGGTGCGGGCCCAGAGAGGGAGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049235842 8:141511880-141511902 CCGTGTGGCCCCGGAGGCAGAGG + Intergenic
1049411476 8:142475703-142475725 GGGTGGGGCCCTGGAGAGGAGGG + Intronic
1049742772 8:144249011-144249033 CGGTGTGCTCCAGGAGAAGGTGG + Exonic
1049789993 8:144468135-144468157 CAGAGGGGCCACGGAGAGGGGGG - Intronic
1049891425 9:73622-73644 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1050376960 9:4984388-4984410 TGGTGTAGCCCGGGAGAGGGTGG - Intergenic
1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG + Intronic
1052995712 9:34550785-34550807 CAGTGTGGAGCTGGAGAGGGTGG - Intergenic
1053732847 9:41074696-41074718 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG + Intronic
1056792273 9:89633555-89633577 AGGTGTGACCCTGGAGAGGTGGG - Intergenic
1059243695 9:112831323-112831345 GGGTGGGGCCCCGGATGGGGTGG - Intronic
1059682844 9:116603403-116603425 CAGTGTGGCCCAGGAGTGGGTGG + Intronic
1060200694 9:121650434-121650456 AGGTGGGGCCCTGGAGTGGGCGG - Intronic
1060991270 9:127850524-127850546 CCGTGTGAACCAGGAGAGGGTGG - Intronic
1061489821 9:130938736-130938758 CGGGGCGGCCCGGGAGCGGGCGG + Exonic
1061817935 9:133207466-133207488 CAGTGTGGACCCGGACACGGAGG + Intronic
1062418159 9:136464086-136464108 CGGTGCTGCCCAGGTGAGGGGGG - Intronic
1062489604 9:136798938-136798960 CGGTGTCCCCCAGGACAGGGCGG + Intronic
1062499102 9:136844746-136844768 CGGTGTTGCCCCGCCGAGGGCGG + Exonic
1187490564 X:19747717-19747739 CGGTGGGGCCCTGGTGAGGGAGG - Intronic
1195328180 X:103775057-103775079 CGGAATGGCCCTGGAGAAGGGGG - Intronic
1197701688 X:129604737-129604759 GGCTGTGACCCCAGAGAGGGAGG + Intergenic
1197874461 X:131088731-131088753 CCGTGTGCCCCGGGAGAAGGAGG + Exonic
1200146630 X:153929742-153929764 AGCTGTGGCCCCGGGGAAGGAGG - Exonic