ID: 1050379526

View in Genome Browser
Species Human (GRCh38)
Location 9:5012248-5012270
Sequence GGATGGAAGAAGAGTAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050379518_1050379526 28 Left 1050379518 9:5012197-5012219 CCTCCTCTGGCCCCTGCCTGTAC 0: 1
1: 0
2: 1
3: 42
4: 470
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379521_1050379526 17 Left 1050379521 9:5012208-5012230 CCCTGCCTGTACACAACAGACTG 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379519_1050379526 25 Left 1050379519 9:5012200-5012222 CCTCTGGCCCCTGCCTGTACACA 0: 1
1: 0
2: 1
3: 46
4: 488
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379517_1050379526 29 Left 1050379517 9:5012196-5012218 CCCTCCTCTGGCCCCTGCCTGTA 0: 1
1: 0
2: 3
3: 43
4: 558
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379516_1050379526 30 Left 1050379516 9:5012195-5012217 CCCCTCCTCTGGCCCCTGCCTGT 0: 1
1: 0
2: 5
3: 109
4: 893
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379520_1050379526 18 Left 1050379520 9:5012207-5012229 CCCCTGCCTGTACACAACAGACT 0: 1
1: 0
2: 1
3: 8
4: 133
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379523_1050379526 12 Left 1050379523 9:5012213-5012235 CCTGTACACAACAGACTGTGTAT 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data
1050379522_1050379526 16 Left 1050379522 9:5012209-5012231 CCTGCCTGTACACAACAGACTGT 0: 1
1: 0
2: 2
3: 11
4: 147
Right 1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050379526 Original CRISPR GGATGGAAGAAGAGTAAGTA TGG Intronic
No off target data available for this crispr