ID: 1050386804

View in Genome Browser
Species Human (GRCh38)
Location 9:5099592-5099614
Sequence TGGTAGGCCTAGAATTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050386804 Original CRISPR TGGTAGGCCTAGAATTGTAG GGG (reversed) Intronic
900056329 1:633727-633749 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
906071325 1:43018871-43018893 TGGTAGGTCCAGAATTCCAGTGG + Intergenic
910169989 1:84367482-84367504 TGAAAGGCCCAGAATTGAAGAGG + Intronic
912146735 1:106803374-106803396 AGGTAGAACTAGAATTGTTGGGG + Intergenic
915713318 1:157921879-157921901 TGTTAGGCCTAGAATAGGAATGG + Intergenic
917145426 1:171885562-171885584 TCTTAGGCCTAAAATTTTAGAGG + Intronic
919415734 1:197306558-197306580 TGGCAAGCTTAGGATTGTAGTGG + Intronic
923899651 1:238311876-238311898 TGATAGGCAGAGAATTGTAGAGG + Intergenic
1064488155 10:15819444-15819466 TGGGAGACCTATAATGGTAGTGG - Intronic
1066088432 10:31994037-31994059 TGGTTGGCCTGGCTTTGTAGTGG + Intergenic
1069584663 10:69590302-69590324 GGGTAGGCCTAGTATTGTTGGGG + Intergenic
1072975913 10:100057616-100057638 GGGTAGGCCTAGTACTGTAGGGG + Intronic
1077207527 11:1352045-1352067 TGGGAGGCCTAGAAGGGGAGTGG - Intergenic
1077207702 11:1352463-1352485 TGGGAGGCCTAGAAGGGGAGTGG - Intergenic
1079397963 11:20082348-20082370 TGGAAGAACTGGAATTGTAGAGG + Intronic
1083715563 11:64573614-64573636 TCGTAGTCCTAGATTTGTAGTGG - Intergenic
1084869574 11:72088926-72088948 AGGCAGGCCTAGAGTAGTAGAGG + Intronic
1087879850 11:103403208-103403230 GGGTAGACCTAGAAATGTTGGGG + Intronic
1094444758 12:30517728-30517750 TGGTATGCAAAGCATTGTAGAGG - Intergenic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1104616023 12:130269407-130269429 TGTCCAGCCTAGAATTGTAGAGG - Intergenic
1106703478 13:32255267-32255289 TGCTAGTCCTACAATTGAAGAGG + Intronic
1108301099 13:49076926-49076948 TGGAAGGCCAAGAATTGAAGGGG - Intronic
1109018864 13:57058624-57058646 TGGTTTGCCTAGAGTTTTAGAGG - Intergenic
1109618294 13:64865878-64865900 TGGTAGCCCTAGCAATGAAGAGG + Intergenic
1109657597 13:65414189-65414211 TGGAAAGCCTAGAATTTAAGAGG - Intergenic
1116110657 14:40576453-40576475 TTGTAGGCCCAGAATTACAGTGG + Intergenic
1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG + Intronic
1125076812 15:35629086-35629108 TGGAATGCCTAGAAATGTATAGG - Intergenic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1126194372 15:45915810-45915832 TGGTTGGCCTGAAATTGTTGGGG + Intergenic
1140877725 16:79168581-79168603 TGGGGGGCCTAGAAATGTGGAGG + Intronic
1142474848 17:182583-182605 TGGGAGGCCTAGAGTAGGAGTGG - Intergenic
1145117657 17:20226319-20226341 TAGTAAGCATAGTATTGTAGAGG + Intronic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1146671805 17:34742892-34742914 TGGAAGGAATAGAGTTGTAGAGG - Intergenic
1150781924 17:68130522-68130544 TGGTATGCCTAGAATAAAAGTGG + Intergenic
1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG + Intergenic
1155571925 18:27203998-27204020 TGGTATGCCTAGAATTCAGGGGG - Intergenic
1165442412 19:35837207-35837229 TGATAGGCACAGTATTGTAGTGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
926012112 2:9416690-9416712 TTGTAGGCCTAAAGTTGTGGAGG - Intronic
928195109 2:29210035-29210057 TGTGAGGCCTAGAATTGTTAAGG - Intronic
929269365 2:39956737-39956759 AGGTAGGCTCAGAATTGTGGAGG + Intergenic
934735615 2:96688397-96688419 GTGAAGGCCTAGAATGGTAGAGG + Intergenic
934900106 2:98153030-98153052 GGGTAGGCCTAGAAGTGAAAGGG - Intronic
937202225 2:120211085-120211107 GGGTAGACCTAGAATTGTTGGGG - Intergenic
938743836 2:134258741-134258763 TGGCAGGTCGAGAGTTGTAGTGG + Intronic
939510672 2:143100559-143100581 GGGTAGGCCTAGAATTGTTGGGG + Intronic
944741342 2:202615795-202615817 AGGTAGACCTAGAATTGTCGGGG - Intergenic
945530267 2:210944727-210944749 GGGTAGGGCTAGAATGATAGTGG + Intergenic
945936891 2:215911727-215911749 TGGAAGGGCTAGAATCGCAGTGG - Intergenic
950820772 3:15756086-15756108 TGGTATGCATAGATTTGTGGGGG - Intronic
950854412 3:16091791-16091813 TGGTTGGTCTGGAATTCTAGTGG + Intergenic
957899218 3:86466708-86466730 TAGCAGGCTTAGAATTTTAGAGG + Intergenic
958143001 3:89587589-89587611 AGGTAGACCTAGAATTGTCAGGG + Intergenic
960023821 3:112986750-112986772 TTGTAGGCCTAGATAGGTAGGGG - Intergenic
961440154 3:126947986-126948008 TGGTGGGCATTGAAGTGTAGCGG + Intronic
965589780 3:170351448-170351470 TGGTAGAATGAGAATTGTAGTGG - Intergenic
966519385 3:180856079-180856101 TGGTGGGACTAGAATTGCAGAGG - Intronic
967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG + Intergenic
970939033 4:21609564-21609586 TGCTAGGACTAGATTTGAAGGGG + Intronic
974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG + Intergenic
974800061 4:66805401-66805423 TGGCAGGCCTATAATTACAGAGG + Intergenic
976096193 4:81510730-81510752 TGGTAAGCCCAGAAATGGAGTGG - Intronic
978312230 4:107397069-107397091 TTGTAGGTCTAGAATTAAAGGGG - Intergenic
979138086 4:117135909-117135931 AGGTGGGCCTAGCATTATAGTGG + Intergenic
982443009 4:155458587-155458609 GGGTAGGCCTAGAATTGTCGGGG + Intergenic
995376632 5:111481443-111481465 TGTTTGGGCTAGATTTGTAGTGG - Intronic
996637274 5:125708629-125708651 TAGTAGGCTTAGAGTAGTAGCGG + Intergenic
998052650 5:139048882-139048904 AGGTAGGCCTATACTTGGAGTGG - Intronic
1006257041 6:32840213-32840235 TGGCAGGACTATAATTTTAGAGG - Intergenic
1008089492 6:47279158-47279180 TAGTGGGCCTAGAAATTTAGAGG - Intronic
1009817856 6:68759015-68759037 TGGTAGGCCATGAACTCTAGAGG + Intronic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1018554784 6:165037884-165037906 TGGTAGGATTAGACTTCTAGGGG - Intergenic
1024380676 7:48692413-48692435 TGGTATTCCTAAAATAGTAGTGG - Intergenic
1026328293 7:69330142-69330164 AGGTAGACCTAGAATTGTTGGGG + Intergenic
1027625428 7:80538795-80538817 TGGTAAGCCAAGAGTTTTAGGGG - Intronic
1032565851 7:132942100-132942122 ATATAGGCCTAGAATTGTATAGG - Intronic
1033014135 7:137654455-137654477 TGGTAGTGATAGAATTGAAGGGG - Intronic
1035647093 8:1232919-1232941 GGGTGGGCCTAGAATGGGAGTGG - Intergenic
1036081672 8:5563354-5563376 TGGTAGGCCTAGAAATTTGTAGG + Intergenic
1036191235 8:6671858-6671880 TGTTAGTCCTAGAATGGCAGAGG + Intergenic
1038784319 8:30597173-30597195 TGCTAGGCCCAGAACTTTAGTGG - Intronic
1042331808 8:67588352-67588374 GGGTAGGCCTAGAATTATTGGGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051210546 9:14737763-14737785 TGGTAGAGCTAGAATTGGACTGG - Intronic
1054864449 9:69985568-69985590 TGGTAGCCTTAGAAGAGTAGAGG - Intergenic
1202629986 M:8558-8580 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
1203343692 Un_KI270442v1:16455-16477 TGGAATGCAGAGAATTGTAGTGG + Intergenic
1188484171 X:30664529-30664551 TAGTAGTGCTAAAATTGTAGAGG + Intronic
1188998284 X:36913447-36913469 TGGTGGTCCTAGAATCTTAGTGG + Intergenic
1189223009 X:39388838-39388860 TGGCAGGCCTATAATTATAGTGG + Intergenic
1192451208 X:71246217-71246239 TGGTTGTCCTAGAATCATAGAGG - Intronic