ID: 1050387589

View in Genome Browser
Species Human (GRCh38)
Location 9:5107328-5107350
Sequence GGTCAAATCTGCCTTCATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 19, 3: 14, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050387589 Original CRISPR GGTCAAATCTGCCTTCATAG GGG (reversed) Intronic
904457758 1:30657647-30657669 GACCACATCTGCCTTCAGAGGGG - Intergenic
906545884 1:46619008-46619030 GGTCAGGGCTGACTTCATAGGGG + Intergenic
908658508 1:66413438-66413460 GGTCCATGCTGCCTTCCTAGAGG - Intergenic
909725654 1:78831880-78831902 GGACAACTCAGCCTTTATAGTGG - Intergenic
918003643 1:180521718-180521740 GGTCAAACCTAACTTCAAAGGGG + Intergenic
923616413 1:235541972-235541994 GGTCAAATCTGCATTCACAGGGG + Intergenic
1064328836 10:14375117-14375139 AGTGAAATCTGACTTCAGAGGGG - Intronic
1065454557 10:25893347-25893369 GGTCAAATCAACCTTTACAGGGG - Intergenic
1068823071 10:61400768-61400790 GGTTATATATGCCTTCATAGAGG + Intergenic
1070934752 10:80284515-80284537 GGTAGAATCTACCTTCAGAGGGG + Intronic
1084583835 11:70042305-70042327 TGTCCAATCTTCCTTCCTAGAGG + Intergenic
1086592923 11:88537233-88537255 GGTCAAATTTGACTACATAATGG + Intronic
1091874043 12:3918968-3918990 GGTCAAGTCTGCCCTCATAATGG + Intergenic
1095945802 12:47752543-47752565 GGTCACATCTGCCATCAGTGGGG - Intronic
1096645006 12:53028097-53028119 TGTCATATCGGTCTTCATAGCGG - Exonic
1098695808 12:73553161-73553183 GTTCAACTCTGCCATGATAGAGG - Intergenic
1101809249 12:108093403-108093425 GATAAAATCTGCTTTCATTGCGG - Intergenic
1110816615 13:79867298-79867320 GGTCAAATCTGTTTTCAAATGGG + Intergenic
1110953870 13:81528382-81528404 GGTCAACTCTGGCTTCTTTGTGG - Intergenic
1111894360 13:94122279-94122301 AGTCAAATGAGACTTCATAGAGG - Intronic
1114921503 14:27337244-27337266 AGTCAAATCTGACCTCAGAGAGG - Intergenic
1116678718 14:47938957-47938979 GCTCAAATTTGCCTTCAGATGGG - Intergenic
1120831478 14:89001076-89001098 TGTGAAATCTGTCTTCATACAGG - Intergenic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1130433782 15:83875458-83875480 GGTCACATTTGCCTTGCTAGTGG - Intronic
1135956585 16:26961142-26961164 GGTCAAATCTGACTTATGAGCGG - Intergenic
1137861635 16:51852555-51852577 GTTAAAATCTGTCATCATAGTGG + Intergenic
1149529530 17:57383726-57383748 GGTCAACTCTGCCTTTAGAAAGG - Intronic
1155329483 18:24700024-24700046 GGTCCATTCTGCGGTCATAGAGG + Intergenic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
926840487 2:17074314-17074336 GGGCAAGACTGCCATCATAGTGG + Intergenic
927109847 2:19856754-19856776 TTTCAAAGCTGCCTTCAGAGGGG - Intergenic
927289492 2:21391984-21392006 TGTCAAATGCCCCTTCATAGTGG + Intergenic
930829730 2:55730223-55730245 GGGCAAATCTGCCTTCCAAGTGG + Intergenic
932968564 2:76509449-76509471 CATCAAATCTGCCTTCACAGAGG + Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945119132 2:206440771-206440793 AATCAAATCAGCATTCATAGAGG - Intergenic
947463399 2:230322120-230322142 GGTCAAACCTGCCCTCAGAAAGG - Intergenic
1169055017 20:2613483-2613505 GGTCCTATTTGCCTTCATAAGGG + Intronic
1171278341 20:23876954-23876976 GGTCAACTCTGCCTGCTTTGGGG - Intronic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1172144271 20:32745154-32745176 GGTCAATTCTGACTTCTCAGAGG - Intergenic
1173072133 20:39778586-39778608 CGTCATAGCTGCCTTCTTAGTGG - Intergenic
1173550850 20:43932294-43932316 TGCCAAATCTGCCTTCATTTAGG + Intronic
1175583750 20:60121150-60121172 GGTCAAATCATCCTCCAAAGAGG + Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1177801844 21:25835645-25835667 GTGCAAATCTGGGTTCATAGAGG + Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
1183151610 22:36042193-36042215 GGCCAAACCTGCCTTCAATGGGG + Intergenic
949452350 3:4200338-4200360 GGCAAAATCTGCCTTCAATGTGG + Intronic
951859761 3:27238943-27238965 GGCCAAATCTTCATTTATAGAGG - Intronic
952610597 3:35204202-35204224 GGTCTAATCTACCTTCTAAGAGG - Intergenic
957203800 3:77168755-77168777 GGTCCAATTTGCCTTCACAGAGG + Intronic
957599746 3:82319253-82319275 GATGAAATCTGCCATCACAGCGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
960944076 3:122953988-122954010 GGTCAAGTCAGTCTTTATAGAGG + Intronic
962154566 3:132932250-132932272 GGTCCCATCTGTCTTCAGAGGGG + Intergenic
962892708 3:139686512-139686534 GCTCAAATCTGCCTTCAGAAAGG - Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
972920536 4:43935603-43935625 TGTCAAATTTGCCTCCATAGAGG - Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
973827093 4:54719168-54719190 GGGCAAATGTGCATTTATAGCGG + Intronic
975608086 4:76176082-76176104 GCCCAAATCAGCTTTCATAGAGG + Intronic
976382521 4:84416003-84416025 GGTCAATTTTGCCTACAAAGAGG + Intergenic
978298454 4:107236972-107236994 TGTCAAATTTTCCTCCATAGTGG + Intronic
978356457 4:107880036-107880058 AGTCCAATCTGCCTTAATATGGG + Intronic
982530736 4:156540139-156540161 AATCAAATCAGCCTTCATGGAGG + Intergenic
983121253 4:163887867-163887889 GGTCAAGTCAGTCTTCTTAGGGG + Intronic
985139402 4:186823464-186823486 TGGCAAATTTGCCTTTATAGTGG - Intergenic
989299036 5:39866791-39866813 GGTCAAATCTGATTTCAAAAGGG + Intergenic
991933850 5:71782669-71782691 CATGAAATCTGCCTTCAAAGAGG - Intergenic
992511860 5:77444584-77444606 GGGCAAATCTGTTTTCAGAGGGG - Intronic
995795792 5:115940268-115940290 GGTCATATATTACTTCATAGTGG - Intergenic
997600247 5:135134091-135134113 GGTCAAAGGTGGCTTCACAGAGG - Intronic
998243795 5:140477286-140477308 GGTCAGATCTGCATTTGTAGTGG + Intronic
1003402233 6:5800048-5800070 GGGGAAATCTGCCTTCAATGTGG - Intergenic
1004184936 6:13413645-13413667 GGTCAATTCTTGCTTCAGAGTGG - Intronic
1008014255 6:46500714-46500736 AGTCAAACCTGCCTTCATAGTGG + Intergenic
1011128618 6:84033015-84033037 GGTCAAAGATGGCTTCACAGTGG - Intergenic
1013296680 6:108763972-108763994 GGTCAAATTTACCTTAACAGAGG + Intergenic
1015671209 6:135692229-135692251 TTTCATATCTGCCTACATAGGGG + Intergenic
1023170408 7:37385799-37385821 CGGCCAATCTGCCTTCACAGAGG + Intronic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1027952201 7:84831263-84831285 GTTCAAAGCTTCCATCATAGGGG - Intergenic
1032073436 7:128824129-128824151 GGTCAGAACTGTCTTCAAAGAGG - Intergenic
1032839823 7:135704850-135704872 GGTGAAATCAGCGTTCACAGTGG - Intronic
1036028914 8:4943797-4943819 TGTCAAATCTTCGTTCATAAGGG - Intronic
1037941575 8:22955501-22955523 GGTCAATTCTGCTTCCATTGTGG + Intronic
1038081348 8:24140285-24140307 TGTCAAAACTGCCATCAAAGAGG - Intergenic
1038344198 8:26717215-26717237 TGTCCAATCTGCCTTCAGGGTGG - Intergenic
1038882131 8:31626500-31626522 ATTCAAATATGCCTTCATATAGG + Intergenic
1043130835 8:76459041-76459063 GCTCAGATCTTCCTTCATAGAGG - Intergenic
1046976318 8:120282294-120282316 GGGCAGATCTGCCTTCAATGTGG - Intronic
1048621804 8:136141913-136141935 GATCACATCGGCCTCCATAGTGG + Intergenic
1050097444 9:2081465-2081487 TGCCAAATCTGCCTTCACATTGG + Intronic
1050387589 9:5107328-5107350 GGTCAAATCTGCCTTCATAGGGG - Intronic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1054988476 9:71291709-71291731 TTACAAATCTGCCCTCATAGTGG + Intronic
1056448779 9:86694246-86694268 GGACAAATCATCCATCATAGTGG + Intergenic
1057072350 9:92110272-92110294 GATCAAATCTACATTCATAAAGG - Intronic
1057563429 9:96146893-96146915 TGTCATATCGGTCTTCATAGTGG - Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1058866716 9:109167417-109167439 GGCCAAATCTGCCTGCGTGGAGG - Intergenic
1059155557 9:111985584-111985606 AGTCAAATCAGACTTCATACAGG - Intergenic
1060146381 9:121256086-121256108 GGTCAAATGAGCCTTTTTAGAGG + Intronic
1061656117 9:132091574-132091596 GGCCAAATCTGTCTTTACAGAGG + Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1189050761 X:37642856-37642878 GGCCAATTCTGAATTCATAGTGG - Intronic
1192124632 X:68490643-68490665 GGTTGAACCTGCCTACATAGTGG - Intergenic
1194324553 X:92496912-92496934 GGCCAAATATGTCTTCTTAGAGG - Intronic
1195262523 X:103147035-103147057 TATCAAATTTCCCTTCATAGTGG - Intergenic
1196079974 X:111620601-111620623 TGTCATATCAGTCTTCATAGCGG + Intergenic
1196528575 X:116756934-116756956 GGGAAAATCTGCCTTCAATGTGG + Intergenic
1196963054 X:121025006-121025028 GGTAGATTCTGCATTCATAGAGG + Intergenic
1197879175 X:131146834-131146856 CATCACATCTGTCTTCATAGTGG + Intergenic
1200633296 Y:5616121-5616143 GGCCAAATATGTCTTCTTAGAGG - Intronic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic
1201666162 Y:16458411-16458433 GTTTAAGTCTGCCTTCAAAGGGG + Intergenic