ID: 1050387648

View in Genome Browser
Species Human (GRCh38)
Location 9:5108005-5108027
Sequence GCTGATAAGTAGGCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050387648 Original CRISPR GCTGATAAGTAGGCTGTGGA TGG (reversed) Intronic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
901286867 1:8087302-8087324 GCTGCTCAGTAGGCTGAGGCAGG - Intergenic
902266414 1:15270020-15270042 GCTACTCAGTAGGCTGTGGAAGG - Intronic
902294733 1:15459272-15459294 GCTGATAGGGAGGCTGAGGTGGG - Intronic
902591376 1:17477272-17477294 GCTGCTCAGTAGGCTGAGGCAGG + Intergenic
902745620 1:18471989-18472011 GCTGCTCAGGAGGCTGTGGCAGG - Intergenic
903727107 1:25457215-25457237 GCTGCTCAGGAGGCTGAGGAGGG - Intronic
904217225 1:28931106-28931128 GCTGAAAAATAGGCTGAGCATGG + Intronic
906259066 1:44372592-44372614 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
906450755 1:45945187-45945209 GCTGCTCAGGAGGCTGTGGTTGG + Intronic
906453741 1:45975554-45975576 GCTGCTCAGTAGGCTGAGGTGGG + Intronic
909904895 1:81182717-81182739 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
911549649 1:99263993-99264015 ACTGAAAAGTAGGCTGAGGTAGG - Exonic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
914242138 1:145859167-145859189 GCTGCTGGGTCGGCTGTGGAGGG - Intronic
914924449 1:151872274-151872296 GCTGATCTTTTGGCTGTGGAAGG + Intergenic
915264040 1:154702153-154702175 GCAGTTCAGTAGGCTGTGGTAGG + Exonic
915424832 1:155817099-155817121 GCTAATTAGTAGGCTGAGGCAGG - Intronic
915438139 1:155924973-155924995 GCTGCTCAGTAGGCTGAGGCAGG - Intronic
915779395 1:158529510-158529532 GTTGATGAGTAGTCTGTAGAGGG - Intergenic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
916692966 1:167208813-167208835 GTTGAGAAGTAGGGTGTGGTGGG - Intergenic
916807681 1:168275175-168275197 GCTGCTCAGGAGGCTGAGGAGGG - Intergenic
916895310 1:169156199-169156221 GCTGCTAGGGAGGCTGAGGAGGG + Intronic
917800286 1:178563449-178563471 GCAGAAAAGGAGACTGTGGAGGG + Intergenic
918478911 1:184956138-184956160 GCTGCTAAGGAGGCTGAGGTAGG - Intronic
919074546 1:192797666-192797688 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
919950308 1:202356931-202356953 GCTAATAAGGAGGCTGAGGCAGG - Intronic
921354885 1:214276621-214276643 GCTAATCAGGAGGCTGAGGAAGG - Intergenic
922136296 1:222830490-222830512 GCTAATCAGGAGGCTGAGGAAGG - Intergenic
922532513 1:226355232-226355254 GCTGCTAGGGAGGCTGTGGTCGG - Intergenic
924584598 1:245350888-245350910 GCTTATAAGTAGGCTGATAATGG + Intronic
924764286 1:247017612-247017634 GCTGCTCAGGAGGCTGAGGAGGG - Intergenic
1063834459 10:9996493-9996515 GCTAATCAGGAGGCTGAGGAGGG + Intergenic
1063884382 10:10562796-10562818 GCAGGGAGGTAGGCTGTGGAGGG - Intergenic
1064030460 10:11879837-11879859 GCTGATAGGTTGTCTGTGGTCGG - Intergenic
1064055394 10:12092987-12093009 GCTACTAAGGAGGCTGAGGAGGG - Intronic
1065037980 10:21660073-21660095 GCTGATCAGGAGGCTGAGGTGGG - Intronic
1065194438 10:23249016-23249038 GCTACTAAGGAGGCTGTGGCTGG + Intergenic
1065283031 10:24159669-24159691 GCTGCTCAGGAGGCTGTGGCAGG + Intronic
1065515622 10:26521563-26521585 ACAGATAAGTAAGCTGAGGAAGG - Intronic
1065988495 10:30981764-30981786 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
1066004057 10:31131161-31131183 GCTAATAAGGAGGCTGAGGAAGG + Intergenic
1067148926 10:43713814-43713836 GCCGAAAAGCATGCTGTGGATGG - Intergenic
1067821916 10:49538345-49538367 ACTGTTAAGTAGGCTGATGATGG + Intronic
1068265247 10:54639971-54639993 GCTGATCTGGAGGCTGAGGAAGG + Intronic
1071799942 10:89048000-89048022 GGTAATAAATAGGATGTGGAAGG - Intergenic
1072593473 10:96849183-96849205 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1073365043 10:102932803-102932825 GCTGATGAGGAGGCTGAGGCAGG + Intronic
1073433818 10:103503899-103503921 GCTACTCAGGAGGCTGTGGAGGG - Intronic
1075706286 10:124503899-124503921 GTTTATAAGTAGGCTGGGCATGG + Intronic
1077796697 11:5499828-5499850 GCTGTTAAGTTGGCAGTGGGTGG - Intronic
1078254679 11:9647882-9647904 CATGATGAGTAGGCTGAGGAGGG + Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1083173709 11:60936908-60936930 GCTGACCAGGTGGCTGTGGAGGG - Exonic
1083390610 11:62347127-62347149 GCTGATATACAGGTTGTGGAGGG - Intronic
1084315834 11:68344972-68344994 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085110982 11:73887859-73887881 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1085151569 11:74256606-74256628 GCTGATCTGTAGGCTCTGCAAGG - Intronic
1085578175 11:77626196-77626218 GCTGCTTAGTAGGCTGAGGTGGG - Intronic
1085672401 11:78480364-78480386 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1086164567 11:83762690-83762712 GCTGTTGAGTAGGCTGAGGCAGG - Intronic
1087078330 11:94146442-94146464 AATGATAAGTGGTCTGTGGAGGG - Intronic
1087771325 11:102213372-102213394 GCTGCTCAGGAGGCTGAGGAGGG + Intronic
1088714275 11:112535113-112535135 GAAGATAAGTAGGCTGAAGAGGG - Intergenic
1089579447 11:119472284-119472306 CATGCTGAGTAGGCTGTGGAGGG + Intergenic
1091569195 12:1669806-1669828 GCTGATCAGGAGGCTGAGGCAGG - Intergenic
1092063750 12:5572327-5572349 GCTGGTAAGTGGGGTGGGGAGGG - Intronic
1092530328 12:9338798-9338820 GCTAATCAGTAGGCTGAGGTGGG - Intergenic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1093637653 12:21490740-21490762 GCTACTAAGGAGGCTGAGGAGGG + Intronic
1093861761 12:24174707-24174729 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1094568820 12:31624240-31624262 GCTGTTCAGGAGGCTGTGGCAGG + Intergenic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1094749684 12:33391432-33391454 GCTTATAAGGAGGCTGTGAGGGG + Intronic
1095054120 12:37580360-37580382 GCTACTATGTAGGCTGAGGAGGG + Intergenic
1096369299 12:51055551-51055573 GCTACTCAGTAGGCTGTGGTGGG + Intronic
1097567255 12:61286575-61286597 GCTACTCAGTAGGCTGAGGAGGG + Intergenic
1098035180 12:66294414-66294436 GCTACTAAGGAGGCTGTGGCAGG - Intergenic
1100172274 12:91988696-91988718 GCTGATAAGTGAACTGTGGCTGG + Intronic
1100335113 12:93621776-93621798 GGTGTTAAGTAGGCTGGGCATGG - Intergenic
1100513906 12:95307282-95307304 GCTGCTCAGTAGGCTGAGGCAGG + Intergenic
1102120103 12:110433621-110433643 GCTACTCAGGAGGCTGTGGAAGG - Intergenic
1102646383 12:114406579-114406601 GGTGATGAGTAGGGGGTGGAGGG - Intronic
1102956776 12:117064034-117064056 GCTGCTCAGGAGGCTGAGGAGGG - Intronic
1102994508 12:117338103-117338125 GCTGATCAGGAGGCTGAGGCAGG + Intronic
1105004609 12:132713584-132713606 GCGGAAAAGGAAGCTGTGGAAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105795616 13:23849179-23849201 GCAGATAAGGAAGCTGTGGATGG - Intronic
1106914635 13:34499287-34499309 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1109323074 13:60833755-60833777 GCTGCTCAGTAGGCTGAGGTAGG - Intergenic
1110996967 13:82122695-82122717 GCTGCTAGGGAGGCTGAGGAAGG - Intergenic
1113500638 13:110771163-110771185 GCTGCTTAGTAGGCTGAGGAGGG - Intergenic
1113988930 13:114343221-114343243 GCTAATCAGGAGGCTGAGGAGGG - Intergenic
1115273543 14:31581161-31581183 GCTGATGAATTGGATGTGGATGG + Intronic
1115321547 14:32084895-32084917 GCTGCTTAGAAGGCTGAGGAAGG + Intronic
1115587861 14:34833128-34833150 GCTGCTAGGGAGGCTGTGGTGGG + Intronic
1115677657 14:35697455-35697477 GCTGCTCAGTAGGCTGAGGCAGG - Intronic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1117528711 14:56637986-56638008 GCTGGGAAGTAGGCTGGTGAGGG + Intronic
1117673735 14:58134438-58134460 ACTTATAAGTAGTCTGTTGAAGG - Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1118407442 14:65440425-65440447 GCTACTAAGTAGGCTGAGGCAGG - Intronic
1118790976 14:69092504-69092526 GCTGCTCAGGAGGCTGAGGAGGG + Intronic
1119462466 14:74819384-74819406 GCTAATAAGGAGGCTGAGGCAGG - Intronic
1121689089 14:95862873-95862895 GCTACTGAGAAGGCTGTGGAGGG + Intergenic
1122930424 14:104930922-104930944 ACTGAGAAGTAGGCAGTGGTGGG - Exonic
1123437802 15:20268317-20268339 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1123698866 15:22899934-22899956 GCTGCTCAGGAGGCTGTGGCAGG + Intronic
1123785307 15:23665264-23665286 GCTAATCAGTAGGCTGAGGCAGG + Intergenic
1123798434 15:23797396-23797418 GATGATAGGTAGGTGGTGGATGG + Intergenic
1123959914 15:25386576-25386598 GCTTATTAGTAGGCTGGGCATGG + Intronic
1124201331 15:27680985-27681007 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1124214137 15:27792610-27792632 GATGCTAACTCGGCTGTGGAGGG - Intronic
1124391357 15:29261264-29261286 GCTGATCAGGAGGCTGAGGAAGG + Intronic
1125342587 15:38689383-38689405 GCTGTGAAGTTGCCTGTGGATGG + Intergenic
1125528943 15:40398506-40398528 GCTGTTAAGCATGTTGTGGAAGG + Intergenic
1126593540 15:50363494-50363516 GCTGCTAAGGAGGCTGAGGTGGG - Intergenic
1128097435 15:64968226-64968248 GCTACTAAGGAGGCTGAGGAGGG + Intronic
1128170293 15:65505372-65505394 TCTGAGCAGTAGGCTGTGGGGGG + Intronic
1129225378 15:74167440-74167462 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1129898021 15:79122892-79122914 GCTGATGGGAAGGCTGGGGAGGG + Intergenic
1130566378 15:84999684-84999706 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
1131236279 15:90699554-90699576 GCTGTTCAGGAGGCTGAGGAAGG + Intergenic
1132068177 15:98750575-98750597 GCTCCTCAGGAGGCTGTGGAGGG + Intronic
1133074406 16:3268929-3268951 GCTACTAAGTAGGCTGAGGCGGG + Intronic
1133877222 16:9746326-9746348 GCTGATCAGGAGGCTGAGGCAGG + Intergenic
1135039453 16:19106825-19106847 GCTGATCAGGAGGCTGAGGCAGG - Intergenic
1136156175 16:28383725-28383747 GCTGAGCACTAGGCTGGGGAGGG + Intronic
1136206911 16:28731563-28731585 GCTGAGCACTAGGCTGGGGAGGG - Intronic
1136846771 16:33582531-33582553 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1138480873 16:57302603-57302625 GCTACTAAGGAGGCTGAGGAAGG + Intergenic
1139869406 16:70093218-70093240 GATGAGAGGTAGGCTGTGAAAGG - Intergenic
1140385979 16:74538995-74539017 GATGAGAGGTAGGCTGTGAAAGG + Intronic
1141566395 16:84905153-84905175 GCTGCTCAGGAGGCTGAGGAGGG + Intronic
1141588655 16:85052206-85052228 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1141771067 16:86089909-86089931 GCTGAGAAGAGGACTGTGGAGGG - Intergenic
1203108479 16_KI270728v1_random:1431186-1431208 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1143696078 17:8619812-8619834 GCTGATAGGGAGGCTGAGGCAGG + Intronic
1143715268 17:8763333-8763355 GCTGTTAAGGAGGCTGAGGTGGG - Intergenic
1144538340 17:16113779-16113801 GCTGCTAAGGAGGCTGAGGCAGG + Intronic
1145400956 17:22532248-22532270 GCTGTTAATTAGGCTGTGAGTGG - Intergenic
1146415215 17:32625659-32625681 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
1146548028 17:33755939-33755961 GATGATAAGCAGGGTGGGGAAGG + Intronic
1146709906 17:35031981-35032003 GCTGATCGGGAGGCTGAGGAAGG + Intronic
1146834854 17:36102576-36102598 GCTGCTCAGTAGGCTGAGGTGGG - Intergenic
1147779608 17:42931229-42931251 GCTGCTCAGGAGGCTGTGGCAGG - Intergenic
1148253330 17:46105757-46105779 GCTACTCAGTAGGCTGAGGAGGG + Intronic
1148842908 17:50510277-50510299 GCTGCTCAGGAGGCTGTGGCAGG + Intronic
1149120759 17:53161307-53161329 GCTACTGAGTAGGCTGAGGAAGG - Intergenic
1149496904 17:57124630-57124652 GCTGCTCAGGAGGCTGAGGAGGG - Intergenic
1150705458 17:67483058-67483080 GCAGATCAGGAGGCTGTGAAAGG - Intronic
1151427074 17:74037927-74037949 GCTGCTAAGGAGGCTGAGGCAGG + Intergenic
1151450606 17:74196252-74196274 GCTAATTAGGAGGCTGTGGCAGG + Intergenic
1152731875 17:81976632-81976654 GCTGCCCAGTAGCCTGTGGAAGG - Intergenic
1153211828 18:2775188-2775210 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
1153568942 18:6449015-6449037 GCTGCTAGGTAGGCTGAGGCAGG + Intergenic
1153803613 18:8693153-8693175 GCTGCTAAGGAGGCTGAGGTGGG - Intergenic
1156969214 18:43134444-43134466 GCTACTCAGTAGGCTGAGGAAGG + Intergenic
1158069321 18:53452094-53452116 GCTGTTAATAAGGCTCTGGAGGG + Intronic
1160633046 18:80259797-80259819 GCTAATCAGGAGGCTGAGGAGGG - Intergenic
1160786949 19:904662-904684 GCTGCTCAGGAGGCTGAGGAGGG + Intronic
1160836119 19:1125245-1125267 GCTGATCAGGAGGCTGAGGCAGG + Intronic
1161345469 19:3766946-3766968 GCTGATCTGAAGGCTGGGGAGGG + Intronic
1161628106 19:5338617-5338639 GCTGATATTTTGGCGGTGGAAGG - Intronic
1161645402 19:5450424-5450446 GCTGATTAGGAGGCTGAGGTAGG + Intergenic
1161833899 19:6631724-6631746 GCTGCTCAGGAGGCTGAGGAGGG - Intergenic
1162124020 19:8489798-8489820 GCTGTTCTGTTGGCTGTGGAGGG + Intergenic
1162415501 19:10534150-10534172 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
1162509427 19:11108738-11108760 GCTAATCAGGAGGCTGAGGAAGG + Intronic
1163081066 19:14942618-14942640 GCTGCTAAGGAGGCTGAGGCAGG - Intergenic
1164462452 19:28460799-28460821 GATGATGAACAGGCTGTGGAAGG + Intergenic
1164694132 19:30230874-30230896 GCTCAAAAGTTGGCTGTGAATGG + Intronic
1168055208 19:53859956-53859978 GCTACTCAGAAGGCTGTGGAGGG + Intergenic
1168420974 19:56203182-56203204 GCTGCTCAGGAGGCTGAGGAGGG - Intronic
925947597 2:8880139-8880161 GCTGAAAAGTAGGCTGCACAGGG + Intronic
926002102 2:9341719-9341741 GCTGAGAACAATGCTGTGGAAGG - Intronic
926364279 2:12118781-12118803 GGTGACAATCAGGCTGTGGAAGG - Intergenic
927148037 2:20179789-20179811 GCAGGCAAGTGGGCTGTGGAGGG - Intergenic
927169772 2:20359349-20359371 GCTGATAACTAGGGGGTAGAAGG - Intergenic
928528296 2:32164391-32164413 GCTGCTAAGAAGGCTGAGGCAGG - Intergenic
929665540 2:43831282-43831304 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
929698820 2:44144052-44144074 GCTGCTAGGTAGGCTGAGGCAGG - Intergenic
929807417 2:45159302-45159324 GCTGCTTAGGAGGCTGAGGAGGG - Intergenic
930279242 2:49350506-49350528 GCTGATCAGGAGGCTGAGGTAGG - Intergenic
931422246 2:62138956-62138978 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
931640026 2:64373927-64373949 GCTGACAGATAGGATGTGGAGGG + Intergenic
932474221 2:71991423-71991445 GCTGAAAGGTAGGCTATGGCAGG + Intergenic
932549923 2:72758049-72758071 GCTGTTCAGGAGGCTGAGGAGGG + Intronic
932768283 2:74485136-74485158 GCTACTCAGTAGGCTGTGGCAGG - Intronic
933162682 2:79043685-79043707 GCTAATAAGAAGGCTGAGGTGGG + Intergenic
933230837 2:79805645-79805667 GATGATAAGTTGGCTGGGCACGG + Intronic
933682036 2:85110611-85110633 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
935211725 2:100944479-100944501 GCTGTAAAGACGGCTGTGGATGG + Intronic
935997055 2:108786339-108786361 GCTGCTAAGGAGGCTGAGGCGGG - Intergenic
938309490 2:130278815-130278837 GCTGATAATTAGGCTGTGAGTGG - Intergenic
938445433 2:131373549-131373571 GCTGATAATTAGGCTGTGAGTGG + Intergenic
938468301 2:131536828-131536850 CGTGATAGGTGGGCTGTGGATGG + Intergenic
939371304 2:141304589-141304611 GCTGCTCAGTAGGCTGAGGCAGG - Intronic
939725642 2:145718114-145718136 GCTGCTAAGGAGGCTGAGGCAGG + Intergenic
941316174 2:163995247-163995269 ACTGATAAGTATGCAGGGGAAGG + Intergenic
941544853 2:166836204-166836226 GCAAATAAGTAGGGTTTGGAAGG - Intergenic
941644201 2:168023024-168023046 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
941741172 2:169036901-169036923 GGTTATAAGTAAGCTGTGGGTGG + Intergenic
942743308 2:179203819-179203841 GCTACTAAGGAGGCTGTGGTGGG + Intronic
943931466 2:193859320-193859342 GCTGCTGAGGAGGCTGTGGTAGG - Intergenic
944770275 2:202907058-202907080 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
945155553 2:206833885-206833907 GCTGGAAAGTAGACTCTGGATGG + Intergenic
945734709 2:213585075-213585097 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
945886837 2:215384915-215384937 GCTGATCAGTAGGCTGGTGGGGG + Exonic
946024039 2:216661212-216661234 GCTGTTCAGGAGGCTGAGGAAGG - Intronic
946421001 2:219564690-219564712 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
947827940 2:233118784-233118806 GCTGACAAGTGTGCTGAGGAGGG - Intronic
948471610 2:238184670-238184692 GCTGCTCAGGAGGCTGTGGTGGG - Intronic
1170148301 20:13201376-13201398 GCTGTTGGATAGGCTGTGGAGGG + Intergenic
1170470191 20:16661090-16661112 GCTACTCAGTAGGCTGTGGTGGG - Intergenic
1171040088 20:21754874-21754896 GCTACTAAGTAGGCTGAGGTAGG + Intergenic
1171305873 20:24105301-24105323 GCTGATGAGTGGGCTATGCAGGG + Intergenic
1172821706 20:37741292-37741314 GCTCATGAGTAGGCTGTGCTTGG + Intronic
1173728380 20:45312324-45312346 CTTGATAAGGCGGCTGTGGAAGG - Exonic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1175083386 20:56439562-56439584 GCTACTCAGGAGGCTGTGGAAGG + Intronic
1175592436 20:60203809-60203831 GCTGATGAGTGGGCTGGGGCAGG - Intergenic
1176877132 21:14142592-14142614 GCTGCTAAGGAGGCTGAGGTGGG - Intronic
1177032358 21:15997043-15997065 GCTACTCAGGAGGCTGTGGAAGG + Intergenic
1177830430 21:26133124-26133146 GCTACTTAGGAGGCTGTGGAGGG + Intronic
1178578107 21:33813462-33813484 GCTACTAAGGAGGCTGAGGAAGG - Intronic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1181143045 22:20821701-20821723 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184256894 22:43292225-43292247 GCTGCCAAGATGGCTGTGGAAGG + Intronic
1184699460 22:46160710-46160732 GCTGCTCAGGAGGCTGAGGAGGG - Intronic
1185008902 22:48302113-48302135 GCTGATATGTATGGTTTGGATGG + Intergenic
1185323671 22:50215354-50215376 GCTGAGGAGTGGGGTGTGGAGGG + Intronic
949586803 3:5448656-5448678 GCTAATAATTAGGCAGTGAAAGG + Intergenic
949735111 3:7162869-7162891 GCTACTAAGTAGGCTGAGGTAGG - Intronic
950408159 3:12817285-12817307 GTTTATGAGCAGGCTGTGGATGG + Exonic
951491108 3:23271520-23271542 GCCAATCAGTAGGCTGTGGGTGG - Intronic
951902756 3:27673235-27673257 GCTACTCAGTAGGCTGTGGCAGG - Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
952768785 3:36978214-36978236 GCTACTAAGGAGGCTGTGGTGGG + Intergenic
953180904 3:40594422-40594444 GCTGATCAGAAGGCTGAGGCAGG - Intergenic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
955251299 3:57285229-57285251 GCTGAAAATTAGGCTGTGCACGG - Intronic
955773295 3:62407501-62407523 GCTAATAAGTAGCCAGTGTAAGG - Intronic
956771327 3:72528454-72528476 GCTGCTAAGGAGGCTGAGGTAGG - Intergenic
957155258 3:76537071-76537093 GCTGAGGAGTGGTCTGTGGAAGG + Intronic
957353263 3:79052864-79052886 ACTGATGAGTAGTCTGTGTATGG + Intronic
958452938 3:94296442-94296464 GCTGATAATTAGGGTGTCTAGGG - Intergenic
958828259 3:99058607-99058629 GCTGATCAGGAGGCTGAGGAGGG - Intergenic
959413568 3:106056340-106056362 GCAGATAAATAGGCTGAGCACGG + Intergenic
959534307 3:107468170-107468192 GCTACTAAGGAGGCTGAGGAGGG + Intergenic
960408252 3:117288475-117288497 GCTGATAAATAGGATGTGGTAGG - Intergenic
960839840 3:121945877-121945899 GCTGCTAGGGAGGCTGAGGAGGG - Intergenic
961009355 3:123425579-123425601 TCTGGTAAATAAGCTGTGGATGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
961684347 3:128618995-128619017 GGTGAGAAGGAGGCTGTGGGAGG - Intergenic
963192395 3:142487246-142487268 GCTGCTCCGTAGGCTGAGGAGGG - Intronic
963402771 3:144822222-144822244 GCTAATAGGGAGGCTGAGGAAGG + Intergenic
964350201 3:155795342-155795364 GCTGATCAGGAGGCTGAGGCAGG + Intronic
968409735 4:379484-379506 GCTAATAAGGAGGCTGAGGCAGG - Intronic
968779386 4:2568406-2568428 GCTGCTCAGGAGGCTGAGGAGGG + Intronic
970526374 4:16936652-16936674 GCTGCTAGGGAGGCTGAGGAGGG + Intergenic
970869997 4:20805052-20805074 GCTGACAAGTAGGTAGTGGTAGG + Intronic
971290722 4:25336596-25336618 GCTGCTGGGGAGGCTGTGGAAGG - Intronic
971512767 4:27447550-27447572 GCTGCTAAGCAGGCTGAGGCAGG + Intergenic
973627777 4:52790265-52790287 GCTGCTCAGGAGGCTGTGGCAGG - Intergenic
974381547 4:61146749-61146771 GCTGCTAAGGAGGCTGAGGCAGG + Intergenic
974915412 4:68172971-68172993 GCTGCTAGGGAGGCTGAGGAAGG + Intergenic
975407776 4:74011610-74011632 GCTACTCAGTAGGCTGAGGAAGG + Intergenic
975869520 4:78764194-78764216 GCTACTAAGGAGGCTGAGGAAGG + Intergenic
975955330 4:79830462-79830484 ACTAATAAGTAGCCTGTAGAGGG - Intergenic
976175935 4:82351429-82351451 GCTGCTAAGGAGGCTGAGGCAGG + Intergenic
978782340 4:112568900-112568922 GCTAATCAGGAGGCTGAGGAAGG + Intronic
978856097 4:113396666-113396688 ATTGATAAGTAGGCCGGGGATGG - Intergenic
979101170 4:116616055-116616077 GCTACTAAGTAGGCTGAGGCAGG - Intergenic
979366016 4:119824595-119824617 GCTGCTAAGGAGGCTGAGGCAGG - Intergenic
979468158 4:121065045-121065067 GCTGCTAAGGAGGCTGAGGCTGG - Intronic
980044115 4:127969856-127969878 GCTACTCAGTAGGCTGTGGAGGG - Intronic
980445250 4:132897606-132897628 CATGTTAAGTAGGCTGAGGAGGG - Intergenic
981097044 4:140792640-140792662 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
981132830 4:141177118-141177140 GCTGCTCAGTAGGCTGAGGTGGG + Intronic
981896218 4:149803454-149803476 GCTTATTAGTAGGCTGAAGATGG - Intergenic
983130789 4:164016650-164016672 GCTGGGAAGGATGCTGTGGAGGG + Intronic
983705851 4:170658657-170658679 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
983827822 4:172286409-172286431 GCAGATAAATAGGATGAGGAGGG + Intronic
984030489 4:174598154-174598176 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
984075825 4:175178572-175178594 GCTGTTAAGTATGTTGTGGGTGG + Intergenic
984715531 4:182921027-182921049 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
985012021 4:185592665-185592687 GCTGCTTAGTAGGCTGAGGTGGG - Intronic
985128153 4:186715301-186715323 ACTGCTGAGTAGGATGTGGAAGG - Intronic
986178935 5:5375818-5375840 GCAGAGCAGTAGGATGTGGAGGG + Intergenic
986535338 5:8780884-8780906 GCTGCTAAGGAGGCTGAGGCAGG - Intergenic
989081554 5:37628034-37628056 GCTACTAAGGAGGCTGAGGAAGG - Intronic
989645962 5:43632905-43632927 TCTGATAAGTACGTTGGGGAGGG + Intronic
989766943 5:45098392-45098414 GCTAATCAGTAGGCTGAGGCAGG - Intergenic
989800606 5:45533923-45533945 TCTGCTAAGTGGGCAGTGGAGGG + Intronic
990472175 5:56125841-56125863 TATGATAAGTAGGCTGGGCACGG + Intronic
990581138 5:57168740-57168762 GCTGCTCAGGAGGCTGTGGCAGG - Intergenic
990998889 5:61762663-61762685 GATTCTAAGTAGGCTGTGAAAGG - Intergenic
991118357 5:62980898-62980920 GCTACTTGGTAGGCTGTGGAGGG - Intergenic
991327710 5:65455428-65455450 GCTGCTCAGTAGGCTGAGGCAGG + Intronic
992061095 5:73048336-73048358 GCTGTTAGGGAGGCTGAGGAAGG + Intronic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
993682314 5:90895038-90895060 GCTGCTCAGTAGGCTGAGGTGGG - Intronic
994031322 5:95147196-95147218 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
994459015 5:100050258-100050280 GCTGATAATTAGGCTGTGGGTGG + Intergenic
995712017 5:115045394-115045416 GCTACTAAGGAGGCTGAGGAGGG - Intergenic
996735994 5:126759041-126759063 GCTGATCAGGAGGCTGAGGCAGG - Intergenic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
997571070 5:134927932-134927954 GCTAATAATTAGGCTGTGAGTGG + Intronic
999517536 5:152316187-152316209 GCTGATAATTAAGGTGTGCACGG + Intergenic
1002525454 5:179813249-179813271 TCTGATAAGGTGGCTGTGGATGG - Intronic
1003164690 6:3665913-3665935 TCTGATGAGTAGGCTGGGGTTGG - Intergenic
1003202987 6:3980121-3980143 GCTGATAGGGAGGCTGAGGTAGG - Intergenic
1003541090 6:7018746-7018768 GCTGCTCAGTAGGCTGAGGCAGG - Intergenic
1004125512 6:12869077-12869099 GCAGATTAGGAGGCTGTGGGTGG - Intronic
1004231346 6:13836361-13836383 GCTCATAACTAGGATGTGAATGG + Intergenic
1005450233 6:25964921-25964943 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
1006070046 6:31491536-31491558 GCTACTCAGTAGGCTGAGGAAGG + Intergenic
1006761321 6:36464428-36464450 GCTGCTCAGGAGGCTGTGGAAGG - Intronic
1007049321 6:38810478-38810500 GCTGCTAGGGAGGCTGTGGCAGG + Intronic
1007497496 6:42270072-42270094 GCTGCTCAGGAGGCTGAGGAAGG + Intronic
1007628417 6:43259478-43259500 GCTGATGAGGCGGCTGTGGGCGG - Intronic
1008139469 6:47815431-47815453 GATGATGAGTAGGCTGTTGCAGG + Intronic
1009463167 6:63938250-63938272 CCTGATAATTAGACTGTGGTTGG - Intronic
1009766253 6:68079660-68079682 GCTGCTAGGAAGGCTGAGGAGGG - Intergenic
1010212736 6:73374935-73374957 GCTGCTCAGGAGGCTGTGGCAGG - Intronic
1011811921 6:91141998-91142020 TCTGATAGGTAGGCAGTGAATGG + Intergenic
1012495726 6:99831558-99831580 GCTGCTAAGAAGGCTGAGGTGGG - Intergenic
1013388842 6:109662224-109662246 TATGATAAGTAAGGTGTGGAAGG + Intronic
1013498504 6:110722752-110722774 GCTACTAAGGAGGCTGAGGAGGG + Intronic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1013788798 6:113812770-113812792 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1014972466 6:127834470-127834492 GCTGCTAAGAAGGCTGAGGTAGG + Intronic
1016482672 6:144498764-144498786 GCTGGTCAGTAGGCTGAGGTGGG - Intronic
1017016028 6:150100179-150100201 GCTGATAAGTAGTCTGGTGCTGG - Intergenic
1018405895 6:163482071-163482093 GCTGCTAGGTAGGCTGAGGAGGG + Intronic
1018841638 6:167521700-167521722 GTTGTTGAGTTGGCTGTGGACGG - Intergenic
1019234677 6:170600524-170600546 GCTAATCAGGAGGCTGAGGAGGG - Intergenic
1019372426 7:669975-669997 GCTGCTAAGGAGGCTGAGGCAGG - Intronic
1020175089 7:5875945-5875967 GCTGCTCAGTAGGCTGAGGTGGG - Intergenic
1021730258 7:23588648-23588670 GCTGATCAGGAGGCTGAGGAGGG + Intergenic
1024029963 7:45451919-45451941 GCAGATTGGGAGGCTGTGGAAGG + Intergenic
1025249627 7:57343270-57343292 GGTGAAAAGTAAGCTGGGGAAGG - Intergenic
1026163875 7:67893044-67893066 GCTACTCAGTAGGCTGAGGAAGG + Intergenic
1026302346 7:69108900-69108922 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1026788522 7:73317163-73317185 GCTGCTAGGTAGGCTGAGGTGGG - Intronic
1026793091 7:73347754-73347776 GCTGCTCAGGAGGCTGGGGAGGG - Intronic
1029127213 7:98302894-98302916 GCTGTTCAGGAGGCTGTGGTGGG - Intronic
1029534496 7:101148442-101148464 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
1030027125 7:105335057-105335079 GCTAATCAGGAGGCTGAGGAAGG + Intronic
1030035981 7:105409084-105409106 GCTGCTAGGTAGGCTGAGGCAGG - Intergenic
1030392657 7:108946327-108946349 GCTACTCAGTAGGCTGAGGAGGG + Intergenic
1030933347 7:115552803-115552825 GCTGAAAAGGAGGCTGTATAAGG - Intergenic
1031482276 7:122292783-122292805 GCTAATTAGGAGGCTGAGGAAGG - Intergenic
1032467333 7:132154174-132154196 GCTGAGAAGGAGGCTGTAGGGGG + Intronic
1032821435 7:135527801-135527823 GCTGCTAAGGAGGCTGAGGTAGG - Intergenic
1032994899 7:137434005-137434027 GCTGCTCAGTAGGCTGAGGCAGG + Intronic
1034070907 7:148183770-148183792 GCAAATAAGTAGGCTGGGCATGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1038635149 8:29280342-29280364 CCTACTAAGTAGGCTGAGGAGGG + Intergenic
1038926042 8:32140571-32140593 GCTACTCAGTAGGCTGAGGAAGG - Intronic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1039439138 8:37582470-37582492 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1039564025 8:38537109-38537131 GCTGCTCAGTAGGCTGAGGGGGG - Intergenic
1040717728 8:50278059-50278081 GCTGCTAAGGAGGCTGAGGTGGG + Intronic
1041222695 8:55667487-55667509 GCTGCTCAGGAGGCTGAGGAAGG + Intergenic
1041518987 8:58733777-58733799 GCTACTAAGGAGGCTGTGGTGGG + Intergenic
1042101288 8:65278160-65278182 GCTACTAAGGAGGCTGAGGAAGG + Intergenic
1043044346 8:75302175-75302197 TATGAAAAGTAGGCTGGGGAAGG - Intergenic
1043623939 8:82231095-82231117 GCTACTAAGTAGGCTGAGGAGGG + Intergenic
1043808963 8:84710411-84710433 GCTACTCAGGAGGCTGTGGAAGG - Intronic
1044587989 8:93885679-93885701 GCTAATCAGTAGGCTGAGGTGGG - Intronic
1044670759 8:94678307-94678329 GCTGGGTAGTACGCTGTGGAGGG - Exonic
1044685499 8:94822577-94822599 GCTGCTCAGGAGGCTGTGGCAGG - Intronic
1044724158 8:95179065-95179087 GCTGCTTAGTAGGCTGAGGCAGG + Intergenic
1044986297 8:97759226-97759248 GCTGCTCAGTAGGCTGAGGCGGG + Intergenic
1045470366 8:102506947-102506969 GCTGCTAAGGAGGCTGAGGCAGG - Intergenic
1046865905 8:119149955-119149977 GCTGCTCAGGAGGCTGGGGAAGG + Intergenic
1046949979 8:120010502-120010524 GCTGATCAGGAGGCTGAGGCAGG + Intronic
1047617044 8:126571339-126571361 GCTGATATGTGGGCTCTGGATGG - Intergenic
1049976460 9:864608-864630 GCTGCTCAGGAGGCTGAGGAAGG - Intronic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1051513349 9:17904543-17904565 GATTGGAAGTAGGCTGTGGAGGG - Intergenic
1051715992 9:19984592-19984614 GCTGCTCAGTAGGCTGAGGCAGG + Intergenic
1052357063 9:27515977-27515999 GCTGATAAGAAGGCCATTGAAGG + Intronic
1053232829 9:36425580-36425602 GCTAATAGGGAGGCTGAGGAAGG + Intronic
1053251331 9:36576641-36576663 GCTGCTAGGGAGGCTGAGGAAGG - Intronic
1053550649 9:39076046-39076068 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1053814758 9:41896145-41896167 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1054615838 9:67291296-67291318 GATGAAAAGGAGTCTGTGGAAGG + Intergenic
1054866115 9:70003780-70003802 GCTTTTAAATAGGCTTTGGAAGG - Intergenic
1056418226 9:86398352-86398374 GCTGCTAAGGAGGCTGAGGCAGG - Intergenic
1056476199 9:86953557-86953579 GCTACTCAGGAGGCTGTGGAGGG + Intergenic
1057477198 9:95412686-95412708 GCTGATAATGAGGCTGCGGTGGG + Intergenic
1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG + Intergenic
1058666094 9:107317292-107317314 GCTGGTAAGTGAGGTGTGGAAGG + Intronic
1058754660 9:108073273-108073295 GCTGATCAGGAGGCTGAGGCAGG - Intergenic
1059306986 9:113361492-113361514 GCTGACAATTAGGATATGGAAGG + Intronic
1059731272 9:117059499-117059521 GCTACTAAGTAGGCTGAGGCAGG + Intronic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061093580 9:128441012-128441034 GCTGCTCAGTAGGCTGAGGTAGG + Intergenic
1061928083 9:133816619-133816641 GCTACTAAGGAGGCTGAGGAAGG + Intronic
1202630272 M:10842-10864 GCTAATAATTAGGCTGTGGGTGG - Intergenic
1185662815 X:1740664-1740686 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1185662856 X:1740979-1741001 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1188822913 X:34797202-34797224 ACTGATGAGTAGTCTGTGTATGG + Intergenic
1189081841 X:37981405-37981427 GCTGCTCAGGAGGCTGAGGAGGG - Intronic
1190679647 X:52813889-52813911 GCTACTAAGTAGGCTGAGGCAGG + Intronic
1191693600 X:63965497-63965519 TCAGATAAGTAGGCTGGAGAGGG - Intergenic
1192741683 X:73899403-73899425 GCTGCTCAGGAGGCTGAGGAGGG + Intergenic
1194695014 X:97036492-97036514 GCAGAAAAATAGGCTGTGTATGG + Intronic
1194756599 X:97745815-97745837 GATGAAAAGGAGGCTTTGGAGGG + Intergenic
1194947521 X:100086915-100086937 GCTGATATTTAGGCTGTACAAGG + Intergenic
1195072216 X:101291752-101291774 GCTGCTCAGTAGGCTGAGGCAGG + Intronic
1196327799 X:114428675-114428697 GCTACTAAGTAGGCTGAGGTGGG + Intergenic
1196821788 X:119707443-119707465 GCTGATCAGGAGGCTGAGGCAGG - Intergenic
1197324087 X:125070077-125070099 GCTACTCAGTAGGCTGAGGAGGG + Intergenic
1197439589 X:126472967-126472989 GCTAATAATTAGGCTGTGAGTGG - Intergenic
1198046104 X:132904637-132904659 GCTGCTAAGGAGGCTGAGGTGGG - Intronic
1198052756 X:132964358-132964380 GCTAATGAGAAGGCTGGGGAGGG + Intergenic
1198122199 X:133605242-133605264 GCTAGTAAGTAGGCTGAGTAGGG - Intronic
1198982396 X:142414387-142414409 GCTGCTCAGGAGGCTGAGGAAGG - Intergenic
1199419426 X:147627018-147627040 GCTGAGAAGTAGACAGTGAATGG - Intergenic
1199681836 X:150230103-150230125 GCAGAGAAGATGGCTGTGGAAGG - Intergenic
1201289195 Y:12406395-12406417 GCTGCTTAGAAGGCTGAGGAGGG + Intergenic