ID: 1050388649

View in Genome Browser
Species Human (GRCh38)
Location 9:5114097-5114119
Sequence CTGGCAGGTGTAGGTGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050388649_1050388653 -9 Left 1050388649 9:5114097-5114119 CCGACCACACCTACACCTGCCAG 0: 1
1: 0
2: 0
3: 26
4: 298
Right 1050388653 9:5114111-5114133 ACCTGCCAGGTCACCTATCAAGG No data
1050388649_1050388657 5 Left 1050388649 9:5114097-5114119 CCGACCACACCTACACCTGCCAG 0: 1
1: 0
2: 0
3: 26
4: 298
Right 1050388657 9:5114125-5114147 CTATCAAGGTAACACCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050388649 Original CRISPR CTGGCAGGTGTAGGTGTGGT CGG (reversed) Intronic
900176627 1:1294034-1294056 CGGGCCGGGGTAGGCGTGGTCGG + Intronic
900462664 1:2808984-2809006 CTCGCAGGTGTGGTTGGGGTGGG + Intergenic
900602687 1:3509766-3509788 CAGGCAGGTGGGGGTGGGGTGGG + Intronic
900829529 1:4955983-4956005 CTGCCTGGTGTATGTATGGTGGG - Intergenic
901530870 1:9851818-9851840 CAGGCAGTTGTGGGTGTGGGTGG - Intronic
901762678 1:11480769-11480791 CTGGCAGGTGTAGTAGTAGGAGG - Intronic
901798955 1:11696193-11696215 GTGGCAGGCATGGGTGTGGTGGG - Intronic
902886263 1:19407149-19407171 CTGGCATATAAAGGTGTGGTAGG + Intronic
902996097 1:20226390-20226412 GTGGCTGGTGTGTGTGTGGTAGG + Intergenic
903329675 1:22590863-22590885 GGGGCAGGTGCAGGTGTGGCAGG - Intronic
903832606 1:26183891-26183913 AAGGCAGGTGTGGGGGTGGTGGG - Intronic
905388651 1:37622255-37622277 CTGGTAAGTGTAGTTTTGGTGGG + Intronic
906535007 1:46546557-46546579 CTGGAGGGTGCAGGTGTGGAGGG + Intronic
907324358 1:53627201-53627223 CTGGGAGGGGGAGGTGTGGGCGG + Intronic
907450252 1:54541778-54541800 CTGGCAGATGCAGACGTGGTTGG - Intergenic
909640459 1:77866478-77866500 TTGGCAGCTGTAGGAGGGGTAGG + Intronic
914746365 1:150504515-150504537 CTGGCAGGAGAGGGTGTGGAGGG - Intronic
915901076 1:159847142-159847164 CTGGCAGGTGTGTGGGTGGGAGG - Intronic
918109301 1:181441758-181441780 CGGGCAGCTGTAAGTGTGTTTGG + Intronic
918355599 1:183704555-183704577 CTGGAAGGTGTTGGTCTGTTAGG + Intronic
919504259 1:198378039-198378061 TTTGCAGGATTAGGTGTGGTAGG - Intergenic
920301071 1:204989453-204989475 CAGGCAGGTGCAGCTCTGGTGGG - Intronic
920434017 1:205936634-205936656 CTGGGAGGTAGAGGGGTGGTGGG - Intronic
920841822 1:209561808-209561830 CTGGCTGGTGTCGGCCTGGTGGG - Intergenic
922064524 1:222124268-222124290 CTGTCAGGTGGGGGTGGGGTGGG - Intergenic
923274566 1:232385190-232385212 CTGGTTGCTGTAGGTGTGGCAGG - Intergenic
923485145 1:234422585-234422607 CTGGGAGGGGTAGTGGTGGTAGG + Intronic
924580959 1:245323951-245323973 GTGGGAGGTGGAGGTGGGGTGGG + Intronic
924775726 1:247113436-247113458 CTGGCAGGAGCAGGTGCTGTGGG + Intergenic
1063193725 10:3720443-3720465 CTGGCATCTTTAGCTGTGGTTGG - Intergenic
1065394694 10:25222165-25222187 GTGGCAGGAGTATGCGTGGTGGG - Intronic
1066610580 10:37243863-37243885 ATGGCAGTTGTAGTGGTGGTGGG + Intronic
1067475581 10:46563827-46563849 TTTGCAGGTGCAGGTTTGGTGGG - Intergenic
1067619154 10:47777948-47777970 TTTGCAGGTGCAGGTTTGGTGGG + Intergenic
1067739175 10:48881770-48881792 CTGGCTGGTGGAGGTGTGAGGGG - Intronic
1070368951 10:75763713-75763735 TTGGCAGGTGTTGGGGAGGTGGG + Intronic
1071532464 10:86400616-86400638 CTGGAAGGTGAGGGTGTGGGAGG - Intergenic
1074228941 10:111514694-111514716 GTGGCAGGAGCAGATGTGGTTGG - Intergenic
1074252008 10:111760463-111760485 CTGGCAGGTGTCAGCGTGTTGGG - Intergenic
1075251759 10:120884205-120884227 GTGGGAGGTGTGGGTGGGGTTGG + Intronic
1075688709 10:124380987-124381009 CAGGCAGGGGCAGGTGTGCTGGG + Intergenic
1076015975 10:127027964-127027986 ATGGCAGATGTGTGTGTGGTGGG + Intronic
1076567963 10:131411868-131411890 TTGGCAGGTGGTGGTGTGGGTGG - Intergenic
1076747694 10:132522667-132522689 CTGCCAGGAGTCGGTCTGGTGGG + Intergenic
1077423972 11:2465896-2465918 CAGGCGGGTCTAGATGTGGTTGG + Intronic
1078337376 11:10474801-10474823 CTGCCAGGTGCAAGTGTGGGTGG + Intronic
1080888958 11:36391960-36391982 TTGGAAGGGGTAGTTGTGGTGGG - Intronic
1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG + Intergenic
1083232121 11:61329275-61329297 CTGGCATGTCTGGGTTTGGTAGG - Intronic
1083273210 11:61582379-61582401 TGGGCAGGTGGAGGTGTGGCTGG - Intergenic
1083545220 11:63544577-63544599 CTGGCAGGGGAAGGTGAAGTAGG - Intronic
1084703755 11:70804130-70804152 CTGGCAGGGGCAGGTCTGGGAGG - Intronic
1084889694 11:72230578-72230600 CTGGCAGGGGTAGGTCTGACAGG + Intronic
1085044122 11:73343436-73343458 CTGGCAGGCGGTGGTGTGGCTGG + Intronic
1088313798 11:108487211-108487233 CTGGAAGGGGTGGGGGTGGTTGG - Intronic
1088472333 11:110199508-110199530 CTGGCAGTGGAAGGTGTGGCAGG + Intronic
1090087345 11:123662414-123662436 ATGGCAGTTGTAGTGGTGGTGGG - Intergenic
1091606104 12:1952807-1952829 CTGGCAGGTGCTGGTGTACTAGG + Exonic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094344751 12:29454855-29454877 CTGTCTGGTGAAGGTGTGGGTGG + Exonic
1095424443 12:42060469-42060491 AGGGCAGGTGTGGGAGTGGTGGG - Intergenic
1096513333 12:52143788-52143810 CCGGCAGGTCTGGGTGTGGGTGG + Intergenic
1097667090 12:62491878-62491900 CTGGCAGGTTTAAATCTGGTAGG + Intronic
1098958662 12:76715014-76715036 CTGGGAGGTGCAGGTGTGGATGG + Intergenic
1100457092 12:94763155-94763177 GTGGCAGGGGTGTGTGTGGTGGG - Intergenic
1101618788 12:106363328-106363350 ATAGCAGGTTTAGGTGTGGAGGG - Intronic
1101946537 12:109141496-109141518 CTGGCTGGTGAAGTTTTGGTTGG - Intronic
1102011821 12:109623831-109623853 GTGTCAGGGGTAGGTCTGGTGGG - Intergenic
1102260079 12:111438164-111438186 GTGGCAGGGGAAGGTGTGGGCGG + Intronic
1103464617 12:121132364-121132386 TTTGCAGGGGTAGGGGTGGTGGG - Intergenic
1103658220 12:122491751-122491773 CTGGCAGGTGGAGGTTGTGTTGG + Intronic
1104736149 12:131137033-131137055 CTGGCAGGTGCAGGTGCAGCTGG + Intronic
1105660063 13:22484457-22484479 TTGACAGGTGTATGTGTTGTTGG - Intergenic
1106292779 13:28380675-28380697 CTGGGTGGTGGAGGGGTGGTGGG + Intronic
1107295985 13:38908000-38908022 ATGGCAGTTGTAGTGGTGGTGGG - Intergenic
1107658402 13:42614865-42614887 CAGGGAGCTGTAGGTGTGGGAGG + Intergenic
1107885447 13:44871203-44871225 CTGGCATGTGTAGGAGAGGGTGG - Intergenic
1109649885 13:65310961-65310983 CTGGCAGATGTGGCAGTGGTGGG + Intergenic
1112027040 13:95420622-95420644 CAGGCAGGTGTCGGTGTGAGGGG + Intergenic
1113182885 13:107651672-107651694 CTGGAAGGTGAAGGTGTGGGTGG - Intronic
1113523242 13:110955059-110955081 CTGGCTGCTGCAGGTGTGCTTGG - Intergenic
1113702067 13:112395437-112395459 CTGGCTGCTGCAGGTGTGGTTGG + Intronic
1113948377 13:114057773-114057795 CTTCCAGGTCTGGGTGTGGTTGG - Intronic
1115336357 14:32247161-32247183 ATGTCAGGTGTAGGGGTGTTGGG + Intergenic
1115339800 14:32281036-32281058 CTGGGAGGTGGAGGTGCAGTGGG + Intergenic
1118592789 14:67413641-67413663 CTGGCAGGTGGGAGTGGGGTTGG - Intergenic
1119599875 14:75968390-75968412 TTGGCAGCTGTGGGGGTGGTGGG + Intronic
1119867083 14:77982673-77982695 CTGCCAGGTGAATGTGTGGCTGG + Intergenic
1119877267 14:78071415-78071437 CTGGCTGGTGTCCCTGTGGTTGG - Intergenic
1122121986 14:99559587-99559609 CTGGCTGGTGAAGTTGTGATCGG - Intronic
1122406287 14:101503135-101503157 CTGGCAGGGGTAGGCGCAGTTGG - Intergenic
1122636771 14:103133660-103133682 CCTGCAGGAGTGGGTGTGGTTGG - Exonic
1125533522 15:40429176-40429198 CTGGCAGGGGATGGAGTGGTGGG - Intronic
1125541195 15:40471061-40471083 CTGGCGCGTGTAGGGGTGGCCGG - Exonic
1126464802 15:48951895-48951917 CTTGCATGAGGAGGTGTGGTAGG - Intronic
1129262631 15:74377270-74377292 CAGGCAGGTGTAGGTGGCCTTGG - Intergenic
1129602760 15:77009865-77009887 CTGGCAGGCGTAGGTGGTGTGGG + Intronic
1131260296 15:90884367-90884389 CTGGCAGGCGTCGGGGCGGTCGG + Intronic
1131285715 15:91055469-91055491 CTGGCCCATGTAGGTGTGGAGGG - Intergenic
1131324450 15:91429006-91429028 CAAGCAGGTGTTGGTGAGGTGGG + Intergenic
1132077653 15:98835694-98835716 CTGGCAGCTTTAGATGTGGTTGG + Intronic
1132500761 16:283646-283668 CTGGCAGCTGGAGGAGTGGCCGG - Intronic
1132505782 16:307977-307999 CTGTCAGGTGGGGCTGTGGTTGG - Intronic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1132892241 16:2210079-2210101 CTGGCAGGTGTCGGTCTGGGGGG - Intronic
1134034028 16:11015869-11015891 CTTGCAGCTGTAGGGGAGGTGGG + Intronic
1134459306 16:14417873-14417895 CTGGGAGAGGTAGCTGTGGTAGG - Intergenic
1137273046 16:46915551-46915573 GTTGCGTGTGTAGGTGTGGTGGG - Intronic
1137273102 16:46916002-46916024 GTGGTATTTGTAGGTGTGGTGGG - Intronic
1137758444 16:50920806-50920828 CTGGCAGGTGTAGCTCAGGGTGG - Intergenic
1137797169 16:51231519-51231541 ATGGCAGTTGTAGTGGTGGTGGG - Intergenic
1138340395 16:56285405-56285427 CTGCCAGGTGGGGGTTTGGTGGG - Intronic
1138563927 16:57818810-57818832 TTGGCAGGTGTAGCTGAAGTGGG - Intronic
1141631197 16:85289009-85289031 CTGGCAGGTGGAGGTGAGGAAGG - Intergenic
1141720397 16:85752297-85752319 CTGGCCGGTGCTGGGGTGGTGGG + Intergenic
1141829462 16:86501696-86501718 CTGGCAGGGGTGGGGGTGGGGGG - Intergenic
1142372826 16:89692368-89692390 CTGGCCAGTGTGGGTGTGGCAGG + Intronic
1143163741 17:4887186-4887208 CTGGCAGGTGGAGTGGGGGTTGG + Intronic
1144833311 17:18143661-18143683 CTGGCAGGTGGGGATGTGGCAGG + Intronic
1144959967 17:19039458-19039480 CTGGCAGGGGGATGTGTGGGGGG - Intronic
1144975193 17:19135066-19135088 CTGGCAGGGGGATGTGTGGGGGG + Intronic
1146448403 17:32951885-32951907 CTGGCAGGAGCAGGTGAGGCTGG - Intergenic
1147114181 17:38286597-38286619 CTGGCAGGAGTGGGAGAGGTTGG - Intergenic
1147268351 17:39248564-39248586 CTGGCATGTGGAGGGGTGGAAGG - Intergenic
1147635620 17:41962152-41962174 CTAGGAGGTGTAGGTGCTGTGGG + Intronic
1148147893 17:45377537-45377559 CTGGCAGGGGCATGGGTGGTTGG - Intergenic
1148415425 17:47502593-47502615 CTGGCAGGAGTGGGAGAGGTTGG + Intergenic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1150644113 17:66967490-66967512 CTGGCAGGTGGAGGCATCGTAGG - Intronic
1150822359 17:68445812-68445834 CAGGCATGTGCAGGGGTGGTCGG - Intronic
1151081974 17:71340032-71340054 CTGGCATGTGTATGTGTTGGAGG + Intergenic
1151556513 17:74849562-74849584 CTGCCAGGTGAGGGTGGGGTTGG - Intronic
1151730681 17:75909448-75909470 CTGGTAGGTGCTGGTGTGGGAGG - Exonic
1151868985 17:76823866-76823888 GTGGTGTGTGTAGGTGTGGTGGG - Intergenic
1152289730 17:79433051-79433073 CCTGCTGGTGTTGGTGTGGTTGG + Intronic
1154945373 18:21157280-21157302 CTGGCAGTGGTAGATGGGGTGGG + Intergenic
1158657540 18:59352715-59352737 CTGCCAGGTGGAGGTGGGGAAGG - Intronic
1160445262 18:78922494-78922516 GTGACAGGTGTGGGTGTGGGTGG - Intergenic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1162183088 19:8883856-8883878 CTGGCAGCTGTAGTGGAGGTGGG + Exonic
1163594321 19:18211979-18212001 GTGCCAGGTCTAGGTGTGGCTGG - Intronic
1164995904 19:32720287-32720309 CTGGGAGGAGTGGGTGTGGAGGG - Intronic
1165130437 19:33628791-33628813 CTGGCTGGATTAGGTGTGGGAGG + Intronic
1165139786 19:33691816-33691838 CAGGCAGGTGTTGGGGTGGAGGG + Intronic
1166190314 19:41172537-41172559 CTAGCATGTGGAGGTGGGGTGGG - Intergenic
1166377243 19:42334390-42334412 CCTGCAGGTGAAGGTGGGGTGGG - Intronic
1166994736 19:46714663-46714685 CTGCCAGGTCCAGGTGTGTTAGG - Intronic
1167374275 19:49102768-49102790 CTAGCAGCTGAAGGTGTCGTAGG + Intronic
925225251 2:2178557-2178579 CAGGAAGGTGTTGGTGAGGTGGG + Intronic
925587062 2:5474927-5474949 CTGGCAGGTGCGGGTGGGGCAGG - Intergenic
927196717 2:20552833-20552855 GTGGCAGGTGCATGTGTGGTGGG + Intergenic
928280410 2:29941331-29941353 GTGGCAGGGGGAGGGGTGGTGGG + Intergenic
929423420 2:41818821-41818843 CTGGGAGGTGGAGGTGTGAGTGG + Intergenic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929966610 2:46542001-46542023 CTGGCTGGTGTGTGTGTGGAGGG + Intronic
930058465 2:47269912-47269934 CTGGCTGGAGTGTGTGTGGTGGG - Intergenic
930353293 2:50285078-50285100 ATGGCAGTTGTAGTTGTAGTGGG + Intronic
931080638 2:58765976-58765998 CTTGCAGGTACAGGTGTGCTGGG + Intergenic
933322888 2:80798996-80799018 CTGGCAGGAGTAAGAGTAGTAGG + Intergenic
934523677 2:95035366-95035388 CCAGCAGGTGTAGATGTGGTAGG + Intronic
934575407 2:95397465-95397487 ATGGCAGGTGCCGGTGTGGAGGG + Intergenic
935211506 2:100942901-100942923 CTGGCAGATGTAGCTGCTGTGGG + Intronic
935285352 2:101559695-101559717 CTGGCAGGAGTAGAGGTGGCTGG - Intergenic
936086594 2:109473722-109473744 CAGGCAGGAGTGGGTGGGGTGGG - Intronic
936097034 2:109538273-109538295 CTGGACTGTCTAGGTGTGGTTGG - Intergenic
936909048 2:117571906-117571928 CAGGCAGGGGTAGGACTGGTTGG + Intergenic
938371526 2:130771645-130771667 CTTGCAGGGGTAGGGGTGGAAGG - Intergenic
938976960 2:136487977-136487999 GTGGCTGGAGTAGGTGTGGAAGG + Intergenic
939366679 2:141242210-141242232 TTGGCAGGTGTCTGTGTAGTGGG - Intronic
940611026 2:155992215-155992237 AAGGGAGGTGGAGGTGTGGTGGG - Intergenic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
944996434 2:205300053-205300075 CTGTCAGGTGTGGGAGTGCTAGG + Intronic
946487117 2:220111472-220111494 CTGGCTGGTATGGGTGGGGTGGG + Intergenic
948185119 2:236014901-236014923 GAGGCAGGTGGAGGTGTGGGCGG - Intronic
948270250 2:236668627-236668649 CTGGCAGCTGGAGGGGAGGTTGG + Intergenic
948654432 2:239468092-239468114 GTGGCATGTGTGTGTGTGGTGGG + Intergenic
1169354766 20:4897268-4897290 TGGGCAGGTGCAGGTGTGCTGGG - Intronic
1171051353 20:21862283-21862305 CAGTCAGGTGTAAGTGTGGGTGG + Intergenic
1171129752 20:22640674-22640696 CTGGCAGGAGTATGAGTGGTGGG + Intergenic
1171207761 20:23294486-23294508 CTGGCAGGTGAGGGTGGGGCTGG - Intergenic
1172227019 20:33311872-33311894 TTGTCAGGTGCAGGTGTGGGGGG - Intergenic
1172850062 20:37955404-37955426 CTGGAAGGTGGTGGTGGGGTGGG - Intergenic
1172885841 20:38230170-38230192 GTGGCAGGGGTAGGAGTGTTAGG + Intronic
1173923892 20:46766143-46766165 GTTGCAGGTGCAGGTGTGGGTGG - Intergenic
1174324347 20:49767323-49767345 CTGCCAGGTATGAGTGTGGTGGG - Intergenic
1174762131 20:53216541-53216563 CTGGCTGGTGAAGGGTTGGTTGG - Intronic
1175251065 20:57610508-57610530 GTGGCGGGTGGAGGTGTGGCGGG - Intronic
1175776182 20:61655109-61655131 ATAGCATGTGTATGTGTGGTAGG + Intronic
1176959082 21:15139432-15139454 CTGGAAGATCTAGATGTGGTTGG + Intergenic
1180832235 22:18912203-18912225 CAGGCAGGGGGAGGGGTGGTGGG - Intronic
1181067607 22:20314139-20314161 CAGGCAGGGGGAGGGGTGGTGGG + Intergenic
1181435231 22:22906582-22906604 CTGGCAGCTGTAGCTTTTGTGGG - Intergenic
1181435954 22:22911001-22911023 CTGGCAGCTGTAGAGGTTGTGGG - Intergenic
1182428368 22:30286526-30286548 CTGGAAGGTGTGGGTGGGGATGG + Intronic
1182577049 22:31280002-31280024 CCAGCAAGTGTAGGAGTGGTGGG + Intronic
1183585303 22:38749943-38749965 CTGGCAGGTGGGGGTGGGGTAGG - Intronic
1184664714 22:45982188-45982210 CTGGCGGAGGGAGGTGTGGTGGG - Intergenic
1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG + Intergenic
1184745519 22:46453529-46453551 CTGCCAGGGCTGGGTGTGGTGGG - Intronic
1203282320 22_KI270734v1_random:137508-137530 CAGGCAGGGGGAGGGGTGGTGGG - Intergenic
951534501 3:23728914-23728936 CTTGCAGGAGGAGGTGTGGCTGG + Intergenic
953381694 3:42477185-42477207 CTGGCTTGTGAAAGTGTGGTGGG - Intergenic
954387231 3:50250528-50250550 CTGGCAGCTGCAGGTGTGACTGG + Intronic
954416248 3:50394827-50394849 CTGACTGGTGGAGGTGTGGCAGG + Intronic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
954709738 3:52499547-52499569 GTCGCAGGGGCAGGTGTGGTGGG - Intronic
954800870 3:53186312-53186334 CTGGAAGGTGCAGATGAGGTGGG - Exonic
955488861 3:59462492-59462514 CTGGCAGGGGCAGGCATGGTGGG + Intergenic
956990431 3:74756796-74756818 CAGGCAGGAGGAGGTGTGCTGGG + Intergenic
959038563 3:101394100-101394122 CTGGGAAGTGTATGTGTGGTGGG - Intronic
959491126 3:106989586-106989608 CTGGTACGTGTAGGTGCGGGAGG - Intergenic
961356888 3:126344980-126345002 GTGGGAGGGGTAGGTGGGGTGGG - Intronic
961491796 3:127261477-127261499 CTGGCAGCTGAGGGTGTGTTGGG + Intergenic
961762662 3:129183373-129183395 CTGGAAGGAGTCCGTGTGGTGGG - Intronic
962193363 3:133334534-133334556 CTGGCAGGAGGAGGTGAGATGGG + Intronic
962254220 3:133859526-133859548 TTTGCTGGTGTAGGTGAGGTAGG - Intronic
968593943 4:1472974-1472996 GTGGCAGGTGGGGGTGTGGCAGG - Intergenic
968869901 4:3236523-3236545 CTGGCAGTTGGGGGTGTGGCAGG + Intronic
969584920 4:8085950-8085972 CTGGCAGGGGTGGGTGTGCTGGG - Intronic
969740323 4:9020263-9020285 CTGGGAGGCGGAGGTTTGGTCGG + Intergenic
972686299 4:41356947-41356969 CTGGGAAGGGTAGTTGTGGTGGG + Intergenic
974723716 4:65773482-65773504 CTGGCAGGTGTGGGGCTGGCTGG + Intergenic
975720999 4:77248491-77248513 CATGCAGGTGTGGGTGGGGTTGG + Intronic
976303263 4:83535567-83535589 ATGGTAGGGGAAGGTGTGGTTGG + Intergenic
977136380 4:93309974-93309996 CTGCCTTGTGTAGGTGGGGTGGG + Intronic
977358997 4:95980704-95980726 CTGCAAGGTCTCGGTGTGGTGGG - Intergenic
979765805 4:124463037-124463059 CTGGTAGGTGTAGTTGGGGCAGG + Intergenic
980212019 4:129801354-129801376 CTGGCAGTGGTGGTTGTGGTGGG + Intergenic
982375628 4:154687716-154687738 CAGGCAGGTGTAGGGGTTGGAGG + Intronic
984717902 4:182943215-182943237 CTGGCAGCTGAAGCTGTGATAGG - Intergenic
985842396 5:2317920-2317942 CTGGCTGCTGTGGGTTTGGTGGG + Intergenic
987148746 5:15017738-15017760 CTGGGAGGTGGGGGTCTGGTGGG + Intergenic
987436140 5:17896147-17896169 CTGACAGGTATATGTGGGGTAGG + Intergenic
991420657 5:66437959-66437981 ATGGCAGGTGTAGTGGTGGTGGG + Intergenic
991772109 5:70050027-70050049 CTGGCTGGTGTGGGGGAGGTGGG + Intronic
991851402 5:70925445-70925467 CTGGCTGGTGTGGGGGAGGTGGG + Intronic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
993030040 5:82695130-82695152 CTGGCAGGTGGAGCTGTAGAGGG - Intergenic
993620366 5:90161227-90161249 CTGGCAGGTATAGGGCTGGGAGG - Intergenic
994007441 5:94855472-94855494 CTGGCAATTGTTGCTGTGGTAGG + Intronic
995365891 5:111360034-111360056 TTTGCAGATGTAAGTGTGGTGGG - Intronic
997309623 5:132868905-132868927 ATGGTGGGGGTAGGTGTGGTTGG + Intergenic
999143449 5:149377790-149377812 CTTGCAGGTGTGGGAGGGGTGGG + Intronic
999480112 5:151940533-151940555 TTGGCAGGAGGAGGTGTGGGGGG + Intergenic
1002388278 5:178887895-178887917 CTGGCAGGGGCAGGGGTGGGGGG - Intronic
1002449534 5:179310923-179310945 CAGGCAGGGGCAGGTGGGGTTGG - Intronic
1003069256 6:2931796-2931818 CTGACAGGTGTAAGTGTAGTGGG - Intergenic
1003855837 6:10273775-10273797 TTTGCTGGTGTGGGTGTGGTAGG - Intergenic
1005033579 6:21534838-21534860 CTGGAAGCTGAAGGTGTGGATGG + Intergenic
1011806668 6:91080044-91080066 GTGGCAGCTGTGGGTGTGCTGGG + Intergenic
1011897659 6:92251741-92251763 CTGTCTGGTGTGGGTGAGGTGGG - Intergenic
1013974271 6:116059146-116059168 CTGGCACTTGGAGGGGTGGTAGG + Intronic
1015102483 6:129497687-129497709 CTGGCAGGATTGGGTGTGATGGG - Intronic
1017723198 6:157258719-157258741 CTGGCTGCTGTGGGTGTGGCTGG + Intergenic
1018372293 6:163179294-163179316 CAGCAAGGTGCAGGTGTGGTGGG - Intronic
1018581624 6:165312961-165312983 CTGGCAGGAGGATGTGGGGTTGG + Intergenic
1018767355 6:166944861-166944883 CTGACAGGTGTGGGCCTGGTGGG - Intronic
1019602161 7:1890132-1890154 CTGTCTGGTGTGGGTATGGTGGG + Intronic
1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG + Intronic
1020628405 7:10610974-10610996 CTGAAAGGTTTAGGAGTGGTTGG - Intergenic
1022189502 7:28003684-28003706 TTGGCAGGTGGAGGTGGGATAGG - Intronic
1022527473 7:31047899-31047921 CTGGAAAGTGTGGGTGTGTTGGG - Intergenic
1023694908 7:42835132-42835154 TTTGCAGGTGTAGGTGGGCTGGG + Intergenic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1026271973 7:68844645-68844667 CAGGCAGGTGTAGAGGTCGTGGG + Intergenic
1026521129 7:71118976-71118998 CTGCTAGGTGTAGGTGTGGCTGG - Intergenic
1026622712 7:71964258-71964280 CAGGCAGGTGTAGGGGTCGTGGG + Intronic
1027047416 7:75000304-75000326 CTGGCAGGGGCAGGGGTGGGCGG + Intronic
1027151012 7:75733655-75733677 CTGGCAGGAGTAGGTATGCAAGG + Intronic
1028570322 7:92279310-92279332 CTGTCAGGAATAGGTGTGGAGGG + Intronic
1029459394 7:100686531-100686553 CTGGCTGGTGTGGGAGTGGCCGG - Intronic
1031535898 7:122932455-122932477 ATGGCAGATGTGGGTGAGGTAGG - Intergenic
1031584501 7:123518309-123518331 TTGGCAGGGGTTGGTGGGGTAGG - Intronic
1031962071 7:127999089-127999111 CTGACTGGTGTAGGTTTGGTAGG + Intronic
1032457897 7:132087517-132087539 CTGGCAGTTGGAGCAGTGGTAGG - Intergenic
1035520866 8:274079-274101 GTGGGAGGTGTGGGTGGGGTTGG + Intergenic
1037640151 8:20735013-20735035 CTGGCAGGGGTAAGCATGGTAGG - Intergenic
1037899176 8:22677554-22677576 GTGGCATGTGTAGGATTGGTGGG + Intergenic
1039264452 8:35809209-35809231 CTGGCAGGAGTAGGTCTGGCTGG - Intergenic
1041006381 8:53500361-53500383 TGGGGAGATGTAGGTGTGGTGGG - Intergenic
1041007276 8:53507928-53507950 GTGGGAGGTGGAGGTGGGGTGGG - Intergenic
1041122578 8:54601918-54601940 AGGGCTGGTGTAGGGGTGGTGGG + Intergenic
1041988512 8:63955786-63955808 CTGGCAGGTTTATTTGGGGTGGG - Intergenic
1042504642 8:69547171-69547193 GTGGCAGGAGGAGGTGGGGTGGG + Intronic
1044873706 8:96644721-96644743 CTGCCAGGTGTAGGATTGTTAGG - Intergenic
1045103482 8:98868120-98868142 ATTGGAGGTGTAGGTGTGGTTGG - Intronic
1045482148 8:102601121-102601143 CTGGCAGGAGCGGGTGTGGGAGG - Intergenic
1047557218 8:125945697-125945719 CTGGTATGTGTGTGTGTGGTGGG + Intergenic
1048632779 8:136262121-136262143 CTGGGAAGTGTGGGTGTGGGTGG + Intergenic
1048871914 8:138806203-138806225 ATGGCATGTGTATGTGTGATGGG + Intronic
1048992285 8:139767530-139767552 CTGGCAGGTGCATGTGGGGGTGG + Intronic
1049171847 8:141166427-141166449 CTTGCAGGTGCAGGAATGGTGGG - Intronic
1049218748 8:141419264-141419286 CTGGCAGCTGTAGGTGTGAGGGG + Intronic
1049287781 8:141785868-141785890 GTGGCAGGTGTGGCTGTGATTGG + Intergenic
1049365808 8:142236333-142236355 CTGGCAGGGGCAGGTGGGGCAGG + Intronic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1051110268 9:13627520-13627542 CTGGCAGGGGCAGGGCTGGTGGG - Intergenic
1053131900 9:35620051-35620073 GTGGCAGGGGTGGGTGGGGTGGG + Intronic
1053246280 9:36537047-36537069 ATGGCAGTTGTAGTGGTGGTGGG + Intergenic
1056128673 9:83563198-83563220 CTGGGAGGTGTAGGGGTAGGGGG - Intergenic
1056536937 9:87536654-87536676 CTGACATGGGTAGGGGTGGTGGG - Intronic
1056881207 9:90395725-90395747 ATGGTAGGTGAGGGTGTGGTGGG - Intergenic
1057228560 9:93305147-93305169 CTGGCAGCTCTTGGTGTGGCTGG - Intronic
1057508053 9:95652817-95652839 TTGGCTGGGGTAGGTTTGGTAGG + Intergenic
1059467575 9:114478679-114478701 CACCCAGGTGTAGATGTGGTTGG + Exonic
1061016385 9:127983153-127983175 CTGCCAGGTTTAGCTGGGGTTGG + Intergenic
1061563356 9:131420820-131420842 CTGCAAGCTGGAGGTGTGGTGGG + Intronic
1061777177 9:132973304-132973326 CCGGCAGGTGCAGGTGGGCTGGG - Intronic
1061825696 9:133256967-133256989 CTGTCAGATGTAGGTGGGGCAGG - Intronic
1186198505 X:7133035-7133057 CTGGAAGGTGTGGGTGGGGATGG + Intronic
1186762881 X:12741681-12741703 CGTGCAGGTGTGGGTGTGGAAGG - Intergenic
1186865040 X:13711873-13711895 CAGGCTGGTGAAGGTGAGGTAGG - Intergenic
1187895290 X:23974594-23974616 CTGGCAGGTGTGGGTGATATAGG + Intergenic
1187914013 X:24135871-24135893 CTGGCAGGTGTGGGTGATATAGG + Intergenic
1188707842 X:33357478-33357500 CTGGCGGGGGTAGGTCTGGTAGG - Intergenic
1189369231 X:40414580-40414602 CTGGCATTTGTAGGTTTGGCTGG + Intergenic
1191011594 X:55765324-55765346 ATGGCATGTATAGGTGAGGTTGG - Intergenic
1191040636 X:56075658-56075680 CTGGGAAGGGTAGGTGGGGTTGG - Intergenic
1194826992 X:98576530-98576552 CTGGCAGGTATACGAGTTGTTGG + Intergenic
1194957943 X:100203027-100203049 CTGGGATGTCTAGGTGTGGTTGG - Intergenic
1195530576 X:105950689-105950711 GTGGCAGATGTAGGTGTTTTGGG + Intronic
1195530635 X:105951773-105951795 GTGGCAGATGTAGGTGTTTTGGG + Intronic
1195735778 X:108011210-108011232 CTAGCTTGTGTAGGTGTGGAAGG + Intergenic
1196738171 X:118999253-118999275 CTGTCAGGAGTTGGTGTGGGTGG + Intronic
1199571920 X:149274777-149274799 CAGGGAAGTGTTGGTGTGGTTGG + Intergenic