ID: 1050391640

View in Genome Browser
Species Human (GRCh38)
Location 9:5149166-5149188
Sequence TCTAGGATCTTAGCTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050391640_1050391644 2 Left 1050391640 9:5149166-5149188 CCTGTAGCAGCTAAGATCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1050391644 9:5149191-5149213 TACATGGCGAGAGTGCCTTTTGG No data
1050391640_1050391645 3 Left 1050391640 9:5149166-5149188 CCTGTAGCAGCTAAGATCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1050391645 9:5149192-5149214 ACATGGCGAGAGTGCCTTTTGGG No data
1050391640_1050391647 9 Left 1050391640 9:5149166-5149188 CCTGTAGCAGCTAAGATCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1050391647 9:5149198-5149220 CGAGAGTGCCTTTTGGGGCCAGG No data
1050391640_1050391646 4 Left 1050391640 9:5149166-5149188 CCTGTAGCAGCTAAGATCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1050391646 9:5149193-5149215 CATGGCGAGAGTGCCTTTTGGGG No data
1050391640_1050391650 29 Left 1050391640 9:5149166-5149188 CCTGTAGCAGCTAAGATCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1050391650 9:5149218-5149240 AGGAACCAGCCATAGCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050391640 Original CRISPR TCTAGGATCTTAGCTGCTAC AGG (reversed) Intronic
901261326 1:7874134-7874156 TCTTGGATCTGAGCTGATCCTGG - Intergenic
901800881 1:11707360-11707382 TCTAGGCTCTTAGCTCCTACCGG - Intronic
904304341 1:29577898-29577920 TCTAGGCTCACAGCTGCTAGAGG + Intergenic
904758843 1:32786617-32786639 GCTAGCATCTCAGCTGCTTCAGG + Intronic
904871536 1:33622137-33622159 TCCAGGGTCTTGGCTGGTACAGG - Intronic
910546225 1:88422519-88422541 TCTGGGATCTTAGCTGATCCTGG - Intergenic
916310551 1:163393981-163394003 TCTAGGATTTTACCTGATACGGG - Intergenic
920986560 1:210896116-210896138 TCTTGGATGTTAGCTGGTATAGG + Intronic
1067442924 10:46321368-46321390 TCTAGGATGTTGTCTGCTTCTGG + Intronic
1067860458 10:49841681-49841703 TCAAGTACCTTAGCTGCTATGGG - Intronic
1071510649 10:86260567-86260589 TCTAGGATGTCATCTGCTACTGG - Intronic
1073776757 10:106794911-106794933 TTTATGATCTTAGCTCCTACAGG - Intronic
1075226545 10:120634604-120634626 TCTAGGAGCATAGCTGGTGCCGG + Intergenic
1076128098 10:127992075-127992097 TCTAGGTTCTTGGGTTCTACTGG - Intronic
1079180718 11:18191004-18191026 TCTTGGATCTTAGCAGCTGAAGG - Intronic
1088143191 11:106643365-106643387 TCTAGGATGTCATCTGCTTCTGG - Intergenic
1089417105 11:118301424-118301446 TCTAGGCTCTGAGCTTCTAGGGG + Intergenic
1094241354 12:28229245-28229267 GCTAGGATCATGGCTGCTGCTGG + Intronic
1098761142 12:74426972-74426994 TCTAGTATTTTAGCTTCTACAGG + Intergenic
1102049343 12:109851142-109851164 TCTTGGATCTTAGCAGCTGAAGG + Exonic
1102652756 12:114454447-114454469 TCTAGAATCATGGCTGCAACGGG - Intergenic
1102789240 12:115630530-115630552 GCCATGATCTTAGCTGCTATAGG - Intergenic
1106975593 13:35208800-35208822 TCTAATATATTTGCTGCTACTGG + Exonic
1108693568 13:52882168-52882190 TCTGGGACCTTAACTGTTACAGG + Intergenic
1108838948 13:54587523-54587545 TCTAGAAACTTAGCTGTTAAGGG + Intergenic
1110496911 13:76178715-76178737 TCTAGGATGTAAGCTCCTAAAGG - Intergenic
1115159930 14:30382397-30382419 CCTTGAATCTTGGCTGCTACAGG + Intergenic
1115379265 14:32715975-32715997 TCTAGGATCTTTGCAGATACTGG + Intronic
1116081449 14:40178761-40178783 TCTAGGATTTTAACTGTTTCAGG + Intergenic
1120537527 14:85715354-85715376 TCCAGGCTCCTAGCTGGTACTGG + Intergenic
1121235327 14:92387760-92387782 TCTAAGAACTTGGCTGCTCCAGG + Intronic
1122208558 14:100160329-100160351 TATTGGATCCTAGCTGCTTCAGG - Intergenic
1127563359 15:60162643-60162665 TTTAAGAACTTAGCTGCTACTGG - Intergenic
1128929713 15:71693319-71693341 TTTAGGATCCTTGCTGCTACTGG - Intronic
1130032631 15:80329334-80329356 TCTAGGACAGTGGCTGCTACAGG - Intergenic
1130575835 15:85092570-85092592 TTTAGGTTCCTTGCTGCTACTGG + Intronic
1140258705 16:73358574-73358596 TGTACCATCTTAGCTTCTACAGG - Intergenic
1142312342 16:89321327-89321349 TCTAGGATCTGAGCTGGGCCAGG + Intronic
1142910793 17:3089278-3089300 TCTGGGCTCTGAGCTGGTACTGG + Intergenic
1151696224 17:75719351-75719373 TCTCGCCTCTCAGCTGCTACAGG + Intergenic
1153065521 18:1040199-1040221 ACCAGGATCTAAGCTGGTACTGG - Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1155605509 18:27601225-27601247 TCTAGGATCTTAAATCATACAGG - Intergenic
1157705750 18:49804317-49804339 TCTAGAATATATGCTGCTACCGG + Intronic
1159680886 18:71350736-71350758 TCTATGATTTTACCTGTTACAGG + Intergenic
1163448684 19:17362659-17362681 TCTAGGATCTCAGTTGCTTCGGG - Intronic
1164388097 19:27794024-27794046 AGTAGCATCTTAGCTGCTTCCGG + Intergenic
1165453244 19:35897058-35897080 TGTAGGATCTTCTCTGCCACAGG - Exonic
927175897 2:20407303-20407325 TCTAGGATGTCATCTGCTTCTGG + Intergenic
940070913 2:149686890-149686912 GCTAGGATCTTGGCTGATGCAGG + Intergenic
944617047 2:201471615-201471637 TCTAAGCTCTCAGCTGCTGCAGG + Intronic
1168863089 20:1060212-1060234 TCTAGGGTTTTAGCTCCTTCTGG - Intergenic
1171244245 20:23597501-23597523 TCTAGAATGTTATCTGCTTCTGG + Intergenic
1171953608 20:31442456-31442478 TCTTGGAGCTTACCTTCTACTGG + Intronic
1175070304 20:56327558-56327580 TCTTAGATCTTAGCTGCACCTGG + Intergenic
1175480101 20:59304638-59304660 TCGAGGATCTGAGATGCTGCAGG + Intronic
1182990627 22:34764109-34764131 GTTAGGATATAAGCTGCTACAGG + Intergenic
1183267180 22:36835576-36835598 GCTAGGATTTTGGCTGCCACTGG - Intergenic
1184450037 22:44577323-44577345 TCTGGGATCTTACCTTCAACCGG - Intergenic
951121016 3:18928810-18928832 TCTAGGATTTTAGATTCTAATGG + Intergenic
953351307 3:42218413-42218435 TCTGGGGGCTGAGCTGCTACAGG + Intronic
953485311 3:43289067-43289089 TGTAGGTTCTTAGAAGCTACTGG + Intronic
959569698 3:107869564-107869586 TCAAGGCTGTGAGCTGCTACAGG + Intergenic
960855683 3:122100022-122100044 TCTAGGGACTGAGCTGCTCCAGG + Intronic
964405462 3:156343926-156343948 GCCAGGATCTTAACTGCTAAAGG - Intronic
964673051 3:159247954-159247976 TCCAGTATCTTATCAGCTACTGG - Intronic
973261098 4:48164627-48164649 GCTAAGATCTTAACTGCTGCTGG - Intronic
980616078 4:135227417-135227439 TCTAGAATCTCAGCTGCTTTGGG - Intergenic
980761366 4:137238498-137238520 ACCAGGATCTTGGCTGGTACTGG + Intergenic
984629279 4:182043427-182043449 TCTAGGGTCTTGGTTTCTACAGG - Intergenic
985232073 4:187829636-187829658 TCTAGCATCTTAACTGTGACAGG - Intergenic
986437550 5:7748797-7748819 GCTAGGCACTTAGCTTCTACTGG + Intronic
987104557 5:14624919-14624941 TTTAGCATTTTAGCTGCTATTGG + Intergenic
993583709 5:89696790-89696812 TCAAGGAACTGAGATGCTACTGG - Intergenic
994180743 5:96763286-96763308 TCCAGGATTATAGCTGCTAATGG - Intronic
995529788 5:113081205-113081227 TCTGTGATCCTAGCTGCTGCGGG - Intronic
995694534 5:114865160-114865182 TCCAGGCTCTGAGCTGGTACTGG + Intergenic
1004737544 6:18422632-18422654 TCCAGGATCTTAGATGCTTCTGG - Intronic
1011324007 6:86129377-86129399 TCTAGGACCCAAGCTGCTGCAGG + Intergenic
1013116285 6:107106115-107106137 TCAAGGAACTTCTCTGCTACAGG + Exonic
1015808229 6:137133655-137133677 TCTGGCATCTTTGCTGCCACTGG + Intergenic
1020686240 7:11298833-11298855 TCCAGGACCTGAGCTTCTACTGG - Intergenic
1024968906 7:55050994-55051016 TCTAGGACCTGAGCTCCTTCTGG + Intronic
1025144253 7:56491243-56491265 TCTAGAAGCTTATCTGCTATGGG - Intergenic
1033629139 7:143140019-143140041 TCTGGGATCTGAGCTGTTGCTGG - Intergenic
1036222358 8:6931324-6931346 TCTAGGAGATTAGCTGCGAAGGG + Intergenic
1043062443 8:75521606-75521628 TCTCGGATCATAGCTTCAACTGG - Intronic
1045423294 8:102038538-102038560 TCTAGGGACTTTGCTGCTATGGG - Intronic
1050391640 9:5149166-5149188 TCTAGGATCTTAGCTGCTACAGG - Intronic
1052803823 9:32994718-32994740 TCTTTGATCTTTGATGCTACTGG + Intronic
1056289610 9:85129361-85129383 TCTAGGAACTTAACAGATACTGG - Intergenic
1059266610 9:113038399-113038421 TTTAGTATTTTAGATGCTACAGG + Intronic
1061897436 9:133655753-133655775 GCTGGGATCTGAGCTGCTGCCGG + Intronic
1062137262 9:134936052-134936074 TCTAGGATCCACGTTGCTACGGG + Intergenic
1203654780 Un_KI270752v1:13018-13040 TCCAGGAACTTAGCTGATGCTGG - Intergenic
1187395536 X:18916059-18916081 TTTAGGATCTTCTCTGCTCCCGG - Intronic
1187788212 X:22917662-22917684 TGTAGAATCTTAGCTGCAAGGGG + Intergenic
1189748922 X:44198723-44198745 TCTAAGCTCTTACCTGCTAAAGG - Intronic
1190641554 X:52485346-52485368 TTTAGAAGCTTATCTGCTACAGG + Intergenic
1190646118 X:52527519-52527541 TTTAGAAGCTTATCTGCTACAGG - Intergenic
1193675478 X:84447381-84447403 TCTAGGCTCTTAGCTCCCACTGG - Intronic
1195838652 X:109148303-109148325 TCTAGGATCTTTGCTGTTTCAGG - Intergenic
1198018773 X:132637612-132637634 CCTATGACCTTAACTGCTACGGG - Intronic