ID: 1050400791

View in Genome Browser
Species Human (GRCh38)
Location 9:5251617-5251639
Sequence TTCCTTATGGATTTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050400791_1050400793 8 Left 1050400791 9:5251617-5251639 CCAGACACAAAATCCATAAGGAA No data
Right 1050400793 9:5251648-5251670 CTTGAATAATATAGACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050400791 Original CRISPR TTCCTTATGGATTTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr