ID: 1050401593

View in Genome Browser
Species Human (GRCh38)
Location 9:5261953-5261975
Sequence CTGGGGTTCGTGAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050401589_1050401593 -10 Left 1050401589 9:5261940-5261962 CCGTTTCCAATTCCTGGGGTTCG No data
Right 1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG No data
1050401585_1050401593 13 Left 1050401585 9:5261917-5261939 CCTTAGATTTTGAGGGGGTCTAT No data
Right 1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050401593 Original CRISPR CTGGGGTTCGTGAGGAAAAC AGG Intergenic
No off target data available for this crispr