ID: 1050402604

View in Genome Browser
Species Human (GRCh38)
Location 9:5271791-5271813
Sequence CAATTATGGCAGAGGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050402604_1050402608 -10 Left 1050402604 9:5271791-5271813 CCTTTCACCCTCTGCCATAATTG No data
Right 1050402608 9:5271804-5271826 GCCATAATTGTAAGTTTTCTGGG No data
1050402604_1050402610 -9 Left 1050402604 9:5271791-5271813 CCTTTCACCCTCTGCCATAATTG No data
Right 1050402610 9:5271805-5271827 CCATAATTGTAAGTTTTCTGGGG 0: 39
1: 956
2: 7128
3: 8457
4: 6410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050402604 Original CRISPR CAATTATGGCAGAGGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr