ID: 1050406102

View in Genome Browser
Species Human (GRCh38)
Location 9:5310002-5310024
Sequence GATGTGACTCACCTTAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406102_1050406107 -10 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406107 9:5310015-5310037 GAGTCACATCTTTGAGGAGGGGG No data
1050406102_1050406109 9 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406109 9:5310034-5310056 GGGGAGTGGAGTAGTTGTGTTGG No data
1050406102_1050406112 29 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406112 9:5310054-5310076 TGGGTAAAAGAGGAATCCACAGG No data
1050406102_1050406111 19 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406111 9:5310044-5310066 GTAGTTGTGTTGGGTAAAAGAGG No data
1050406102_1050406108 -5 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406108 9:5310020-5310042 ACATCTTTGAGGAGGGGGAGTGG No data
1050406102_1050406110 10 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406110 9:5310035-5310057 GGGAGTGGAGTAGTTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406102 Original CRISPR GATGTGACTCACCTTAAGAT TGG (reversed) Intergenic
No off target data available for this crispr