ID: 1050406107

View in Genome Browser
Species Human (GRCh38)
Location 9:5310015-5310037
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406102_1050406107 -10 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406107 9:5310015-5310037 GAGTCACATCTTTGAGGAGGGGG No data
1050406100_1050406107 1 Left 1050406100 9:5309991-5310013 CCACAGGAGCACCAATCTTAAGG No data
Right 1050406107 9:5310015-5310037 GAGTCACATCTTTGAGGAGGGGG No data
1050406099_1050406107 9 Left 1050406099 9:5309983-5310005 CCAGGCTGCCACAGGAGCACCAA No data
Right 1050406107 9:5310015-5310037 GAGTCACATCTTTGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406107 Original CRISPR GAGTCACATCTTTGAGGAGG GGG Intergenic