ID: 1050406111

View in Genome Browser
Species Human (GRCh38)
Location 9:5310044-5310066
Sequence GTAGTTGTGTTGGGTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050406102_1050406111 19 Left 1050406102 9:5310002-5310024 CCAATCTTAAGGTGAGTCACATC No data
Right 1050406111 9:5310044-5310066 GTAGTTGTGTTGGGTAAAAGAGG No data
1050406100_1050406111 30 Left 1050406100 9:5309991-5310013 CCACAGGAGCACCAATCTTAAGG No data
Right 1050406111 9:5310044-5310066 GTAGTTGTGTTGGGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050406111 Original CRISPR GTAGTTGTGTTGGGTAAAAG AGG Intergenic